Bug in entret.

[simon andrews (BI)]

Following on from my query yesterday, I have hit a problem trying to
implement a multiple search because of what appears to be a bug in entret.

I am using a series of fasta flat files, indexed with dbifasta.  What I am
finding is that although I can retrieve entries from the database with
seqret, using entret always returns an empty file with the same accession
number:

############

%> entret htg_mus:AC092094_v6_c8
Reads and writes (returns) flatfile entries
Output file [ac092094_v6_c8.entret]: 
%> more ac092094_v6_c8.entret
%> seqret htg_mus:AC092094_v6_c8       
Reads and writes (returns) sequences
Output sequence [ac092094_v6_c8.fasta]: 
%> more ac092094_v6_c8.fasta
>AC092094_v6_c8 Mus musculus clone RP23-261m19, WORKING DRAFT SEQUENCE, 8
unordered pieces.
CAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAACAAAAAAACAAAAAAAAA
ACAAAAGAAGAAGAAAATGTCTGTGAATACCCTGGAAAAGTTACTCAGTGAAAGTAGATG
AGTCCCTGAGTCAGTGACAGGAAGTGAGTGCAGTCTGAGCACTGGCTTGTGACCAATGAC
AAAAACATAAGCTAGACTTGCTCTGCAAAGTGGAGGACAGAACAGACAAAGCCCCAGAGT

etc. etc.
############

entret doesn't produce any errors, but if I run it with the -debug option I
see the following lines in entret.dbg


############
Initializing seqInFormat, 40 formats
ajSeqRead: input file '/data/MOUSE/HTG/htg_mus.fasta' still there, try again
seqRead: single access - count 1 - call access routine again
seqAccessEmblcd type 1
query data all finished
seqRead: seqin->Query->Access->Access(seqin) *failed*
ajSeqallNext failed
closing file 'ac092094_v6_c4.entret'
############

I've checked, and the /data/MOUSE/HTG/htg_mus.fasta file is definitely
there, and is readable, so I suspect that something in the EMBOSS internals
is going wrong.

This is using EMBOSS 2.0.0.  Is this a known bug?  Is there a fix on the
way?  I can bluff the script using seqret in this case, but I'd like to make
a more general solution eventually.

	Cheers
	
	Simon.