[DAS2] Sequence retrieval proposal

[Nomi Harris]

On 8 December 2005, Thomas Down wrote:
 > > There's already a huge number of existing sequence file formats.
 > > What would another provide?  Are some of them already extensible?
 > >
 > > Several of those formats are designed and developed by people involved
 > > with DAS.  If it's important, extend GAME or GFF.
 > 
 > Do GAME or GFF have a sequence representation?  I thought they were  
 > both primarily feature-table formats

GAME certainly has a sequence representation, and i think GFF3 must,
though old GFF doesn't.

<game>
  <seq id="3R:1178000-1230000" length="52001" focus="true">
    <name>3R:1178000-1230000</name>
    <organism>Drosophila melanogaster</organism>
    <residues>
      AAGCCCACTATATTGCATTAAATTATGCGATAATTGATCAATTTTAAAGG
...
    </residues>

 > (right now I'm having trouble  
 > finding the GAME documentation though...).

http://www.fruitfly.org/annot/apollo/game.rng.txt

        Nomi