[BioRuby] Melting Temperature

[McCreavy David]

Hi Rob,

Many thanks.

Kind Regards, David

David McCreavy
PACS/RIS Manager
Radiology Department
Direct Line 0151 600 1705 | Mobile 0788 7362868
Liverpool Heart & Chest Hospital NHS Foundation Trust
Thomas Drive | Liverpool | L14 3PE

This e-mail and any attachments may contain confidential and / or proprietary Trust information, some or all of which may be legally privileged, and may be subject to public disclosure under the NHS Code of Openness or the Freedom of Information Act 2000.
The information held herein should only be used for its initial intended purpose(s). It is for the exclusive use of the intended recipient(s) only and any unauthorised use, storage, disclosure, copying, distribution or dissemination may be unlawful. If you are not the intended recipient then please notify the author by replying to this e-mail and then destroy any copies.
Any views or opinions expressed in this e-mail are those of the author and do not necessarily represent those of the Trust. All incoming and outgoing e-mails and other forms of telecommunication may be monitored.

From: Rob Syme [mailto:rob.syme at gmail.com]
Sent: 09 October 2014 15:36
To: McCreavy David
Cc: bioruby at mailman.open-bio.org
Subject: Re: [BioRuby] Melting Temperature

Hi David

The 'bioroebe' gem includes Tm calculation.

    $ gem install bioroebe
    $ irb

    > require 'bioroebe/calculate_melting_temperature'
    > seq = 'ATGCTGACGTATGCGATCGTA'
    > tm = CalculateMeltingTemperature.new
    > tm.set_input(seq)
    > tm.calculate_tm
    # ==> 65.32166985617363

You can set oligo nucleotide concentration, Na+ conc and formamide_concentration.

The method isn't too complicated<http://rubydoc.info/gems/bioroebe/0.0.44/CalculateMeltingTemperature:calculate_tm>

Rob Syme

On Thu, Oct 9, 2014 at 6:10 AM, McCreavy David <David.McCreavy at lhch.nhs.uk<mailto:David.McCreavy at lhch.nhs.uk>> wrote:
Hi Guys,

Where in the API will I find methods for calculating Tm?

Kind Regards, David




----------------------------------------------------------------------------------------------------------------

This e-mail and any attachments may contain confidential and / or proprietary Trust information, some or all of which may be legally privileged, and may be subject to public disclosure under the NHS Code of Openness or the Freedom of Information Act 2000.

The information held herein should only be used for its initial intended purpose(s).  It is for the exclusive use of the intended recipient(s) only and any unauthorised use, storage, disclosure, copying, distribution or dissemination may be unlawful.  If you are not the intended recipient then please notify the author by replying to this e-mail and then destroy any copies.

Any views or opinions expressed in this e-mail are those of the author and do not necessarily represent those of the Trust.  All incoming and outgoing e-mails and other forms of telecommunication may be monitored.

Warning: Although the company has taken reasonable precautions to ensure no viruses are present in this email, the company cannot accept responsibility for any loss or damage arising from the use of this email or attachments.



_______________________________________________
BioRuby Project - http://www.bioruby.org/
BioRuby mailing list
BioRuby at mailman.open-bio.org<mailto:BioRuby at mailman.open-bio.org>
http://mailman.open-bio.org/mailman/listinfo/bioruby


----------------------------------------------------------------------------------------------------------------

This e-mail and any attachments may contain confidential and / or proprietary Trust information, some or all of which may be legally privileged, and may be subject to public disclosure under the NHS Code of Openness or the Freedom of Information Act 2000. 

The information held herein should only be used for its initial intended purpose(s).  It is for the exclusive use of the intended recipient(s) only and any unauthorised use, storage, disclosure, copying, distribution or dissemination may be unlawful.  If you are not the intended recipient then please notify the author by replying to this e-mail and then destroy any copies.

Any views or opinions expressed in this e-mail are those of the author and do not necessarily represent those of the Trust.  All incoming and outgoing e-mails and other forms of telecommunication may be monitored.

Warning: Although the company has taken reasonable precautions to ensure no viruses are present in this email, the company cannot accept responsibility for any loss or damage arising from the use of this email or attachments.