[BioRuby] GSOC: Bioruby PhyloXML update 12
Christian M Zmasek
czmasek at burnham.org
Fri Aug 14 18:41:13 UTC 2009
Very nice!!
I guess this will be placed/copied to the BioRuby tutorial (at
http://bioruby.open-bio.org/wiki/Tutorial) at one point, correct?
A very tiny, minuscule even, issue I noticed (and maybe even a problem
of my web browser):
A the very end, the blue box seems broken at the "wrong place" -- so to
speak, i.e.
"#Once we know whats there, lets output just sequences
phyloxml.other[0].children.each do |node|
puts node.value
end"
and
"#=>
#
#acgtcgcggcccgtggaagtcctctcct
#aggtcgcggcctgtggaagtcctctcct
#taaatcgc--cccgtgg-agtccc-cct"
should be in the same box, but they appear to be in different ones.
Christian
Diana Jaunzeikare wrote:
> Hi all,
>
> I added here a HOWTO for BioRuby PhyloXML implementation
>
> https://www.nescent.org/wg_phyloinformatics/BioRuby_PhyloXML_HowTo_documentation
>
> Let me know, what you think
>
> Diana
>
> On Mon, Aug 10, 2009 at 3:54 PM, Diana Jaunzeikare <rozziite at gmail.com
> <mailto:rozziite at gmail.com>> wrote:
>
> Hi all,
>
> What was done last week:
>
> * Coding. Added changes so that now it is completely compatible with
> phyloxml schema 1.10
>
> * Testing. added more unit tests (now writer has 9 tests, 26
> assertions; parser: 40 tests, 134 assertions)
>
> * Profiling. I discovered that writer is really slow. The reason is
> the implementation of the Tree#children method, which does
> bfs_shortest_path algorithm. I had idea of tracking node children
> inside the node class as an array, but Naohisa Goto pointed out that
> then I would also have to deal with new node, edge addition,
> removal, etc. So better solution seems to, for now leave it as it
> is, and first improve Bio::Tree class. I am planning to do that
> after GSOC, since there is only one week left.
>
> * Refactored parser class, got around 3-fold speed increase. Now it
> can parse Metazoa taxonomy 33MB file in ~14 seconds (Ubuntu 9.04,
> ruby 1.8.7 [i486-linux], Intel Core 2 Duo P8600 @2.4GHz)
>
> Next week:
>
> * Create howto wiki page with code examples and usage.
> * Do more testing (Anybody has some more phyloxml xml files for me
> to test, other than those on phyloxml.org <http://phyloxml.org>?)
> * Any other suggestions from you?
>
> Questions/issues:
>
> * Where should the HOWTO and code example documentation go? Seems
> reasonable for it to go here
> http://bioruby.open-bio.org/wiki/HOWTO:Trees and/or
> http://bioruby.open-bio.org/wiki/Phyloxml_tree_format (which is
> linked from previous link).
>
> * How does integration to the master branch goes? Is all i have to
> do is pull_request on github?
>
> * I have implemented PhyloXML::Sequence#to_biosequence, however it
> returns incomplete data, since info for
> Bio::Sequence#classification, Bio::Sequence#species,
> Bio::Sequence#division would come from PhyloXML::Taxonomy class, but
> it is not accessible from Sequence class. Should there be
> PhyloXML::Node#to_biosequence method which would gather information
> from both PhyloXML::Sequence and PhyloXML::Taxonomy? or maybe
> Bio::Sequence should not hold taxonomic information?
>
> You are all welcome to test my code. It is available on
> http://github.com/latvianlinuxgirl/bioruby/tree/dev
>
> Thanks,
>
> Diana
>
>
More information about the BioRuby
mailing list