[BioRuby] spidey parser
    jan aerts (RI) 
    jan.aerts at bbsrc.ac.uk
       
    Wed Nov  8 14:20:08 UTC 2006
    
    
  
All,
I'm trying to use the spidey parser (Bio::Spidey) to find mismatches in
the sequence between mRNA and genomic sequence. For example the C/T
mismatch at the end of the last line in the snippet below.
<SNIP>
Exon 3: 46694102-46690011 (gen)  152-4244 (mRNA)
TATTTTGCAGATAAGTCATCATGGTGAAAAGCCACATAGGCAGTTGGATCCTGGTTCTCT
          ||||||||||||||||||||||||||||||||||||||||||||||||||
          ATAAGTCATCATGGTGAAAAGCCACATAGGCAGTTGGATCCTGGTTCTCT
               V  I  M  V  K  S  H  I  G  S  W  I  L  V  L
ACAGGCCAGTGGATCAGTATAGTAACCAGAACAACTTTGTGCATGACTGTGTCAACATCA
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
ACAGGCCAGTGGATCAGTATAGTAACCAGAACAACTTTGTGCATGACTGTGTCAATATCA
Y  R  P  V  D  Q  Y  S  N  Q  N  N  F  V  H  D  C  V  N  I
</SNIP>
I couldn't find out exactly how to walk through all segments of the
alignment and get to the midline. The
Bio::Spidey::Report::SegmentPair#initialize method in the
bio/appl/spidey/report.rb file mentions that it "is designed to be
called from Bio::Spidey::Report::* classes." and that "users shall not
call it directly."
How can I walk over all segment pairs and access the mRNA and genomic
sequences as well as the midline?
Many thanks,
Dr Jan Aerts
Bioinformatics Group
Roslin Institute
Roslin, Scotland, UK
+44 131 527 4200
---------The obligatory disclaimer--------
The information contained in this e-mail (including any attachments) is
confidential and is intended for the use of the addressee only.   The
opinions expressed within this e-mail (including any attachments) are
the opinions of the sender and do not necessarily constitute those of
Roslin Institute (Edinburgh) ("the Institute") unless specifically
stated by a sender who is duly authorised to do so on behalf of the
Institute. 
    
    
More information about the BioRuby
mailing list