[BioRuby] Parsing a file in Swissprot format
n at bioruby.org
n at bioruby.org
Fri Dec 2 22:41:04 EST 2005
Hi Uarban,
Your input file is a entry (SM0000001) in S/MARt DB.
* S/MARt DB
http://smartdb.bioinf.med.uni-goettingen.de/SMARtDB/browse/index.html
* SM0000001
http://smartdb.bioinf.med.uni-goettingen.de/cgi-bin/SMARtDB/getSMAR.cgi?SM0000001
>
> Here's my input file:
>
> AC SM0000001
> XX
> DT 1.1.1999 00:00:00 (created); ili
> DT 8.12.2004 12:49:00 (updated); ili2
> XX
> NA MOUSE$kappa-MAR
> XX
> OS mouse, Mus spec.
> OC eukaryota; animalia; metazoa; chordata; vertebrata;
> OC tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
> OC murinae
> XX
> HO human, rabbit [2]
> XX
> SZ 371 bp
> XX
> DE G000538; immunoglobulin kappa light chain
> DP Direction: 3'; Pos 1: ATG
> DN Internal: y;
> DC between joining and constant regions [1]; ~200 bp
> DC upstream of the kappa enhancer [1]
> XX
> SQ AAGCTTAATGTATATAATCTTTTAGAGGTAAAATCTACAGCCAGCAAAAGTCATGGTAAA
> SQ TATTCTTTGACTGAACTCTCACTAAACTCCTCTAAATTATATGTCATATTAACTGGTTAA
> SQ ATTAATATAAATTTGTGACATGACCTTAACTGGTTAGGTAGGATATTTTTCTTCATGCAA
> SQ AAATATGACTAATAATAATTTAGCACAAAAATATTTCCCAATACTTTAATTCTGTGATAG
> SQ AAAAATGTTTAACTCAGCTACTATAATCCCATAATTTTGAAAACTATTTATTAGCTTTTG
> SQ TGTTTGACCCTTCCCTAGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCTTGAAACT
> SQ ACTTTAGAGTC
> SC [7]
> XX
> FT 2 - 11: cleavage by topoisomerase II [3]
> FT 2 - 15: deleted in plasmacytoma PC 7183 [3]
> FT 5 - 14: cleavage by topoisomerase II [3]
> FT 5 - 14: 5'-recombination junction [3]
> FT 8 - 17: cleavage by topoisomerase II [3]
> FT 10 - 19: cleavage by topoisomerase II [3]
> FT 32 - 41: cleavage by topoisomerase II [3]
> FT 53 - 62: cleavage by Drosophila topoisomerase II only
> FT [3]
> FT 68 - 77: cleavage by topoisomerase II [3]
> FT 69 - 78: cleavage by topoisomerase II [3]
> FT 73 - 82: cleavage by topoisomerase II [3]
> FT 98 - 107: cleavage by Drosophila topoisomerase II only
> FT [3]
> FT 147 - 156: cleavage by topoisomerase II [3]
> FT 163 - 284: confers MAR-like features upon any DNA when
> FT contiguously reiterated in the same molecule
> FT [7]
> FT 164 - 170: similar motif found in human PARP MAR
> FT SM0000116 [8]
> FT 182 - 191: cleavage by topoisomerase II [3]
> FT 189 - 198: cleavage by topoisomerase II [3]
> FT 219 - 228: cleavage by topoisomerase II [3]
> FT 242 - 251: cleavage by topoisomerase II [3]
> FT 248 - 257: cleavage by topoisomerase II [3]
> FT 253 - 253: G in [3]
> FT 256 - 265: cleavage by topoisomerase II [3]
> XX
> SF topoisomerase II sites [1]; AT-rich sites [1];
> SF contains a breakpoint for chromosomal translocation [3];
> SF several short stretches of homopolymeric adenine or
> SF thymine [7]
> XX
> BP 75% [J. Bode, direct submission]; 20% [7]
> TP constitutive [1]
> XX
> FF prototype of a S/MAR; contributes to maximal expression of
> FF the kappa gene [2]; contributes to hypermutation [9];
> FF contributes to kappa expression as shown by flow cytometic
> FF assay, but has little effect on accumulation of the
> FF respective mRNA [9]
> XX
> CP liver, kidney, spleen, thymus, MPC-11, P-815, L-cell [1]
> XX
> EV in vitro selection of S/MAR
> EC [J. Bode, direct submission]
> XX
> BF SB000002; lamin A [6]
> MM nitrocellulose filter binding;
> SO rl; rat
> QA 6
> BF SB000003; lamin B1 [6]
> MM nitrocellulose filter binding;
> SO rl; rat
> QA 6
> BF SB000004; lamin C [6]
> MM nitrocellulose filter binding;
> SO rl; rat
> QA 6
> BF SB000018; SP120 [4]
> MM nitrocellulose filter binding;
> SO brain; rat
> QA 6
> BF SB000018; SP120 [4]
> MM southwestern blotting;
> SO brain; rat
> QA 6
> BF SB000022; topoisomerase II [3]
> MM gel retardation;
> SO Drosophila; Drosophila melanogaster
> QA 6
> BF SB000022; topoisomerase II [3]
> MM topoisomerase II cleavage assay;
> SO Drosophila; Drosophila melanogaster
> QA 6
> BF SB000043; topoisomerase II [3]
> MM topoisomerase II cleavage assay;
> SO calf; calf
> QA 6
> BF SB000045; SMI1 [5]
> MM functional analysis;
> PR 254 bp fragment
> SO yeast, extract; baker's yeast, Saccharomyces cerevisiae
> QA 6
> BF SB000052; topoisomerase II [3]
> MM topoisomerase II cleavage assay;
> SO mouse; mouse
> QA 6
> BF SB000053; topoisomerase II [3]
> MM nitrocellulose filter binding;
> SO HeLa; human
> QA 6
> BF SB000067; SMAR1 [10]
> MM gel shift competition;
> SO rec(mouse-E.coli); mouse
> QA 6
> BF SB000077; SAF-A [12]
> MM supershift (antibody binding);
> SO liver; mouse
> QA 6
> BF SB000077; SAF-A [12]
> MM southwestern blotting;
> SO liver; mouse
> QA 6
> XX
> RN [1]
> RX MEDLINE; 86106203 PubMed; 3002631
> RA Cockerill, P. N., Garrard, W. T.
> RT Chromosomal loop anchorage of the kappa immunoglobin gene
> RT occurs next to the enhancer in a region containing
> RT topoisomerase II sites
> RL Cell 44:273-282 (1986)
> RN [2]
> RX MEDLINE; 90078219 PubMed; 2512290
> RA Blasquez, V. C., Xu, M., Moses, S. C., Garrard, W. T.
> RT Immunoglobulin kappa gene expression after stable
> RT integration. I. Role of the intronic MAR and enhancer in
> RT plasmacytoma cells
> RL J. Biol. Chem. 264:21183-21189 (1989)
> RN [3]
> RX MEDLINE; 89315824 PubMed; 2546156
> RA Sperry, A. O., Blasquez, V. C., Garrard, W. T.
> RT Dysfunction of chromosomal llop attachment sites:
> RT Illegitimate recombination linked to matrix association
> RT regions and topoisomerase II
> RL Proc. Natl. Acad. Sci. USA 86:5497-5501 (1989)
> RN [4]
> RX MEDLINE; 93286136 PubMed; 8509422
> RA Tsutsui, K., Tsutsui, K., Okada, S., Watarai, S., Seki, S.,
> RA Yasuda, T., Shohmori, T.
> RT Identification and characterization of a nuclear scaffold
> RT protein that binds the matrix attachment region DNA
> RL J. Biol. Chem. 268:12886-12894 (1993)
> RN [5]
> RX MEDLINE; 93296190 PubMed; 8516310
> RA Fishel, B. R., Sperry, A. O., Garrard, W. T.
> RT Yeast calmodulin and a conserved nuclear protein
> RT participate in the in vivo binding of a matrix associated
> RT region
> RL Proc. Natl. Acad. Sci. USA 90:5623-5627 (1993)
> RN [6]
> RX MEDLINE; 94344140 PubMed; 8065361
> RA Luderus, M. E. E., den Blaauwen, J. L., de Smit, O. J. B.,
> RA Compton, D. A., van Driel, R.
> RT Binding of matrix attachment regions to lamin polymers
> RT involves single-stranded regions and the minor groove
> RL Mol. Cell. Biol. 14:6297-6305 (1994)
> RN [7]
> RX MEDLINE; 96222527 PubMed; 8670229
> RA Okada, S., Tsutsui, K., Tsutsui, K., Seki, S., Shohmori, T.
> RT Subdomain structure of the matrix attachment region located
> RT within the mouse immunoglobulin kappa gene intron
> RL Biochem. Biophys. Res. Commun. 222:472-477 (1996)
> RN [8]
> RA Boulikas, T., Kong, C. F., Brooks, D., Hsie, L.
> RT The 3' untranslated region of the human
> RT poly(ADP-ribose)polymerase gene is a nuclear matrix
> RT anchoring site
> RL Int. J. Oncol. 9:1287-1294 (1996)
> RN [9]
> RX MEDLINE; 97377037 PubMed; 9233808
> RA Goyenechea, B., Klix, N., Williams, G. T., Riddell, A.,
> RA Neuberger, M. S., Milstein, C.
> RT Cells strongly expressing Ig kappa transgenes show clonal
> RT recruitment of hypermutation: a role for both MAR and the
> RT enhancers
> RL EMBO J. 16:3987-3994 (1997)
> RN [10]
> RX MEDLINE; 20408892 PubMed; 10950932
> RA Chattopadhyay, S., Kaul, R., Charest, A., Housman, D.,
> RA Chen, J.
> RT SMAR1, a novel, alternatively spliced gene product, binds
> RT the scaffold/matrix-associated region at the T cell
> RT receptor beta locus
> RL Genomics 68:93-96 (2000)
> RN [11]
> RX MEDLINE; 20496822 PubMed; 11041885
> RA Morisawa, G., Han-yama, A., Moda, I., Tamai, A., Iwabuchi,
> RA M., Meshi, T.
> RT AHM1, a novel type of nuclear matrix-localized, MAR binding
> RT protein with a single AT hook and a J
> RT domain-homologous region
> RL Plant Cell 12:1903-1916 (2000)
> RN [12]
> RX MEDLINE; 21456956 PubMed; 11573239
> RA Lobov, I. B., Tsutsui, K., Mitchell, A. R., Podgornaya, O.
> RA I.
> RT Specificity of SAF-A and lamin B binding in vitro
> RT correlates with the satellite DNA bending state
> RL J. Cell. Biochem. 83:218-229 (2001)
> //
Best,
Mitsuteru
-
<n at bioruby.org>
Mitsuteru Nakao <nakao-mitsuteru at aist.go.jp>
<http://seq.cbrc.jp/%7Enakao/>
Sequence Analysis Team <http://seq.cbrc.jp>
Compuational Biology Research Center (CBRC) <http://www.cbrc.jp>
National Institute of Advanced Industrial Science and Technology (AIST)
BioRuby Project <http://bioruby.org>
b-Src <http://b-Src.cbrc.jp/markup>
More information about the BioRuby
mailing list