[BioRuby-cvs] bioruby/doc Tutorial.rd,1.17,1.18
Pjotr Prins
pjotr at dev.open-bio.org
Tue Feb 5 12:01:26 UTC 2008
Update of /home/repository/bioruby/bioruby/doc
In directory dev.open-bio.org:/tmp/cvs-serv32092/doc
Modified Files:
Tutorial.rd
Log Message:
Minor tweak to Tutorial.rd
Index: Tutorial.rd
===================================================================
RCS file: /home/repository/bioruby/bioruby/doc/Tutorial.rd,v
retrieving revision 1.17
retrieving revision 1.18
diff -C2 -d -r1.17 -r1.18
*** Tutorial.rd 3 Feb 2008 17:17:48 -0000 1.17
--- Tutorial.rd 5 Feb 2008 12:01:16 -0000 1.18
***************
*** 129,135 ****
bioruby!> print counts
! a6c2g2t2
bioruby!> p counts
! {"a"=>6, "c"=>2, "g"=>2, "t"=>2}
--- 129,135 ----
bioruby!> print counts
! a6c2g2t2
bioruby!> p counts
! {"a"=>6, "c"=>2, "g"=>2, "t"=>2}
***************
*** 173,183 ****
* Shows average percentage of GC content for 20 bases (stepping the default one base at a time)
! bioruby> seq = Bio::Sequence::NA.new("atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa")
==> "atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa"
bioruby> seq.window_search(20) { |s| print s.gc_percent,',' }
! 30,35,40,40,35,35,35,30,25,30,30,30,35,35,35,35,35,40,45,45,45,45,40,35,40,40,40,40,40,35,35,35,30,30,30, ==> ""
-
Since the class of each subsequence is the same as original sequence
(Bio::Sequence::NA or Bio::Sequence::AA or Bio::Sequence), you can
--- 173,182 ----
* Shows average percentage of GC content for 20 bases (stepping the default one base at a time)
! bioruby> seq = Bio::Sequence::NA.new("atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa")
==> "atgcatgcaattaagctaatcccaattagatcatcccgatcatcaaaaaaaaaa"
bioruby> seq.window_search(20) { |s| print s.gc_percent,',' }
! 30,35,40,40,35,35,35,30,25,30,30,30,35,35,35,35,35,40,45,45,45,45,40,35,40,40,40,40,40,35,35,35,30,30,30, ==> ""
Since the class of each subsequence is the same as original sequence
(Bio::Sequence::NA or Bio::Sequence::AA or Bio::Sequence), you can
More information about the bioruby-cvs
mailing list