[BioRuby-cvs] bioruby/test/unit/bio test_sequence.rb,1.5,1.6

[Mitsuteru C. Nakao]

Update of /home/repository/bioruby/bioruby/test/unit/bio
In directory pub.open-bio.org:/tmp/cvs-serv30733/test/unit/bio

Modified Files:
	test_sequence.rb 
Log Message:
* test_common.rb: added.
* test_compat.rb: added.
* test_sequence.rb: moved some test codes to test_common.rb or test_compat.rb.


Index: test_sequence.rb
===================================================================
RCS file: /home/repository/bioruby/bioruby/test/unit/bio/test_sequence.rb,v
retrieving revision 1.5
retrieving revision 1.6
diff -C2 -d -r1.5 -r1.6
*** test_sequence.rb	26 Nov 2005 06:51:45 -0000	1.5
--- test_sequence.rb	5 Feb 2006 17:39:27 -0000	1.6
***************
*** 1,6 ****
  #
! # test/unit/bio/tc_sequence.rb - Unit test for Bio::Sequencce
  #
  #   Copyright (C) 2004 Moses Hohman <mmhohman at northwestern.edu>
  #
  #  This library is free software; you can redistribute it and/or
--- 1,7 ----
  #
! # test/unit/bio/test_sequence.rb - Unit test for Bio::Sequencce
  #
  #   Copyright (C) 2004 Moses Hohman <mmhohman at northwestern.edu>
+ #   Copyright (C) 2006 Mitsuteru C. Nakao <n at bioruby.org>
  #
  #  This library is free software; you can redistribute it and/or
***************
*** 30,33 ****
--- 31,35 ----
  module Bio
    class TestSequence < Test::Unit::TestCase
+ 
      def setup
        @na  = Sequence::NA.new('atgcatgcatgcatgcaaaa')
***************
*** 36,61 ****
      end
  
-     def test_to_s_returns_self_as_string
-       s = "abcefghijklmnop"
-       sequence = Sequence.new(s)
-       assert_equal(s, sequence.to_s, "wrong value")
-       assert_instance_of(String, sequence.to_s, "not a String")
-     end
- 
-     def test_subseq_returns_nil_blank_sequence_default_end
-       sequence = Sequence.new("")
-       assert_nil(sequence.subseq(5))
-     end
  
-     def test_subseq_returns_nil_start_less_than_one
-       sequence = Sequence.new("blahblah")
-       assert_nil(sequence.subseq(0))
-     end
-     
-     def test_subseq_returns_subsequence
-       sequence = Sequence.new("hahasubhehe")
-       assert_equal("sub", sequence.subseq(5,7))
-     end
-     
      # "main" method tests translated into unit tests
      
--- 38,42 ----
***************
*** 125,154 ****
      end
      
-     # Test Sequence#to_fasta
-     
-     def test_to_fasta
-       sequence = Sequence.new("agtc"*10)
-       header = "the header"
-       assert_equal(">the header\n" + ("agtc"*5) + "\n" + ("agtc"*5) + "\n", sequence.to_fasta(header, 20))
-     end
-     
-     # Test Sequence#window_wearch
-     
-     def test_window_search_with_width_3_default_step_no_residual
-       sequence = Sequence.new("agtca")
-       windows = []
-       returned_value = sequence.window_search(3) { |window| windows << window }
-       assert_equal(["agt", "gtc", "tca"], windows, "windows wrong")
-       assert_equal("", returned_value, "returned value wrong")
-     end
-     
-     # added
-     def test_window_search_with_width_3_step_two_with_residual
-       sequence = Sequence::NA.new("agtcat")
-       windows = []
-       returned_value = sequence.window_search(3, 2) { |window| windows << window }
-       assert_equal(["agt", "tca"], windows, "windows wrong")
-       assert_equal("t", returned_value, "returned value wrong")
-     end
      
      # Test Sequence#total
--- 106,109 ----