[Biopython] How to do RNA-RNA hybridization searches?

[Chris Mitchell]

If you want to do it in python, it's fairly trivial.

a = 'CGACGUAUGUUAUGAGCUGAUGGUCACGUGUCGAUGGCUAUAG'
for i in xrange(0,len(a)-14):
    if a[i:i+15] in seq2:
        do this

or is there some reason you aren't taking this approach?


On Thu, Oct 10, 2013 at 3:33 PM, Eric Ma <ericmajinglong at gmail.com> wrote:

> Hi everybody,
>
> I'm looking to try my hand at doing the following problem:
>
> I have a sequence of RNA, say, "RNA SEQUENCE 1":
> "...CGACGUAUGUUAUGAGCUGAUGGUCACGUGUCGAUGGCUAUAG..."
>
> I have another sequence of RNA, say "RNA SEQUENCE 2".
>
> I'd like to do 15-mer sliding window searches from RNA Sequence 1 (it'll
> take a long time, I'm sure, but nonetheless that's what I'd like to do),
> such that I search:
>
> "[*CGACGUAUGUUAUGA*]GCUGAUGGUCACGUGUCGAUGGCUAUAG"
> "C[*GACGUAUGUUAUGAG*]CUGAUGGUCACGUGUCGAUGGCUAUAG"
> "CG[*ACGUAUGUUAUGAGC*]UGAUGGUCACGUGUCGAUGGCUAUAG" etc. etc.
>
> along RNA Sequence 2, to see if I can find that same region present.
>
> I was wondering if there was some package that could do that, that either
> BioPython interfaces with, or is separately implemented as a Python
> package. Does anybody know if there is such a thing?
>
> Cheers,
> Eric
> -----------------------------------------------------------------------
> Please consider the environment before printing this e-mail. Do you really
> need to print it?
>
> http://about.me/ericmjl
> _______________________________________________
> Biopython mailing list  -  Biopython at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biopython
>