[Biopython] alignment/matching algorithm whichs allows missmatches at certain positions

[Stefanie Lück]

Hi everybody!

Does someone knows an algorithm to search for sequence similarity by allowing missmatches at certain positions?

E.g.
Looking in a sequence database for 

ATGCTCGCGCTCGCTCGCGCA

by allowing an missmatch at position [3] and [18].

I can do it via regular expressions but I guess it would be quite slow. 

Thanks for any hints!
Stefanie