[BioPython] Random sequence

[pan at uchicago.edu]

Also see a 2-liner coding sequence:

>>> def codingSeq(size=30, stopCodons=['TAG','TAA', 'TGA'], sep=''):
	codons = [x+y+z for x in 'AGTC' for y in 'AGTC' for z in 'AGTC' \
                    if x+y+z not in stopCodons]
 	return sep.join([ random.choice(codons) for x in range(size/3) ])

>>> codingSeq()
'AATGTTTCACTAGGTGACGTGTCGTGGCTA' 

>>> codingSeq(sep=' ')
'GGT GCT AAG TTC CGA TCG AAC AGA AAC TGT'



Quoting pan at uchicago.edu:

> You can make a random seq with one line of python code:
> 
> >>> import random
> 
> >>> ''.join([random.choice('AGTC') for x in range(10)]) 
> 'GGTTTCGGTA'
> 
> >>> ''.join([random.choice('AGTC') for x in range(10)]) 
> 'GCGGGTCCGT'
> 
> >>> ''.join([random.choice('AGTC') for x in range(10)]) 
> 'AAAAGCACTG'
> 
> Isn't it beautiful? 
> 
> pan
> 
> 
> 
> 
> 
> 
> 
> 
> Quoting ashleigh smythe <absmythe at ucdavis.edu>:
> 
> > On Wed, 2004-06-16 at 07:45, Sebastian Bassi wrote:
> > > Is there a way to generate a random DNA sequence with biopython?
> > > If not, I could submit a function to do it, but before doing it, I'd 
> > > want to see if its not already done.
> > 
> > Hi Sebastian.  I wasn't able to find a random sequence generator in the
> > biopython modules so I wrote a simple little one of my own a few months
> > ago- it only uses biopython modules to add the sequence to a
> > biopython-parsed file.  It is quite ugly and brute force as I'm a
> > beginner - I'd be curious to see what you come up with.  In case you are
> > curious, here it is:
> > 
> > #This is designed to generate random DNA sequence data and add
> > #it to the end of a biopython-parsed sequence record
> > #in fasta format.
> > #Modified 2-20 to just make random seq. data for a taxon,
> > #rather than adding it onto the existing sequence.
> > 
> > import random
> > import string
> >                                                                            
>  
> >                                                                            
>  
> >                                                                            
>  
> >            
> > def generate(n):                  #generate the dna sequence of n length
> >     bases=['A', 'T', 'G', 'C']
> >     dna_in_list=[]
> >                                                                            
>  
> >                                              
> >     while n > 0:
> >         abase=random.choice(bases)
> >                                                                            
>  
> >                                              
> >         dna_in_list.append(abase)
> >         n=n-1
> >                                                                            
>  
> >                                              
> >     dnastring=str(dna_in_list)     #format the list into a string.  
> >     better_dnastring=string.join(string.split(dnastring),"") #Take
> >     better2_dnastring=string.strip(better_dnastring)         #out
> >     better3_dnastring=better2_dnastring.replace(',','')      #unwanted
> >     better4_dnastring=better3_dnastring.replace(']','')      #characters
> >     better5_dnastring=better4_dnastring.replace('[','')
> >     better6_dnastring=better5_dnastring.replace("'",'')
> > 
> >     return better6_dnastring
> >    
> >  
> > def add_seq(n):                #this is how start 
> >     import sys                 #the program:seqgen.add_seq(file, n).
> >     from Bio import Fasta                                     
> >     parser=Fasta.RecordParser()
> >     afile=open(file_to_add_to, 'r')
> >     iterator=Fasta.Iterator(afile, parser)
> >  
> >     out_file=open('randomadded.nex', 'w')
> >  
> >     while 1:                   #loop through each record and add the new
> >         seq_to_add=generate(n) #sequence
> >         cur_record=iterator.next()
> >         if cur_record is None:
> >             break
> >         title_and_seq=string.split(cur_record.title)
> >         title='>' + title_and_seq[0] + '\n'
> >         new_record=title + 'N' + seq_to_add
> >         out_file.write(new_record)
> >         out_file.write('\n')
> > 
> > 
> > Ashleigh
> > 
> > _______________________________________________
> > BioPython mailing list  -  BioPython at biopython.org
> > http://biopython.org/mailman/listinfo/biopython
> > 
> 
> 
> _______________________________________________
> BioPython mailing list  -  BioPython at biopython.org
> http://biopython.org/mailman/listinfo/biopython
>