From lisa3375v50@hotmail.com Wed Oct 2 01:24:25 2002
From: lisa3375v50@hotmail.com (lisa3375v50@hotmail.com)
Date: Tue, 01 Oct 2002 23:24:25 -0100
Subject: [BioPython] Girls drinking cum from a cup.
Message-ID: <003a57d30a1d$8272e8a3$8be43eb8@nripot>
Everyone Knows That Good Girls Always Share Their Candy!
These Nasty Sluts Trade Cum Wads Mouth To Mouth Style.
Take The 3 day Unlimited Access Trial! Click here
If you cannot view the above message, click the link below
http://rd.yahoo.com/dir/?http://www.4megsfree.com/~beat/
To be removed from this list email removes5654@hotmail.com
2530FGqw1-247plAo3632tVzl23
From taylor8142u63@mailcity.com Tue Oct 1 03:40:44 2002
From: taylor8142u63@mailcity.com (taylor8142u63@mailcity.com)
Date: Tue, 01 Oct 2002 13:40:44 +1100
Subject: [BioPython] Girls drinking cum from a glass.
Message-ID: <016c03c81c7b$8544d5a6$1de36bc8@vtmelm>
Everyone Knows That Good Girls Always Share Their Candy!
These Nasty Sluts Trade Cum Wads Mouth To Mouth Style.
Take The 3 day Unlimited Access Trial! Click here
If you cannot view the above message, click the link below
http://rd.yahoo.com/dir/?http://www.4megsfree.com/~beat/
To be removed from this list email removes5654@hotmail.com
3873WKqF5-785TQHp9724YZpr5-557Yl29
From prentum@prentum.com Sun Oct 13 18:51:18 2002
From: prentum@prentum.com (prentum@prentum.com)
Date: Mon, 14 Oct 2002 01:51:18 +0800
Subject: [BioPython] Stockpiling Heat Insoles
Message-ID: <200210131646.g9DGkS4Q001807@pw600a.bioperl.org>
Good day!
We have a patent invention for Stockpiling Heat Insoles. The Stockpiling Heat Insoles made by new stockpiling heat material and possesses points as listed below:
1) In winter, a pair of the Stockpiling Heat Insoles can keep warm and comfortable for feet for 4 hours as soon as they be filled with heat, and the spare pair can offer warm and comfortable for more long.
2) No put any electric heating material in the insoles, they feel no different from ordinary cloth insoles. Loading heat for the Stockpiling Heat Insoles is by a special electrothermal box with autocontrol and resistance of heat leak, and filling heat takes only 2 hours.
3) The Stockpiling Heat Insoles are agree with many people into a situation without warm to keep out the cold for their feet, like students, bicyclers, motorcycle drivers, sentinels, outdoor laborers, travelers, etc. The potential market is tempting !!!
4) Only need ordinary sewing equipments for production of this item. The making technology is easily to learn.
5) The total costs of 2 pair of insole along with the electrothermal box can be within 1.0 USD in China. Investments for daily production of 500 pairs is only about 2000 USD in China.
We are ready to make over the making technology at a unhigh price, the terms is negotiable. If you are really interested to buy the making technology about this item, don't hesitate to contact us, and let us know your idea along with contact details about you or your company.
Best regards
Mr. Long Tan
Prentum Develoment Corp.
No 229 Rongshan Road, Lingui, Guilin, Chian
Fax: ++86-773-5592687
Email: prentum@prentum.com
=============================================================
该邮件使用 科特邮件群发软件 发送,邮件内容与科特软件无关
科特软件 http://www.caretop.com
=============================================================
From dna106@nhri.org.tw Wed Oct 16 04:52:09 2002
From: dna106@nhri.org.tw (dna106)
Date: Wed, 16 Oct 2002 11:52:09 +0800
Subject: [BioPython] download
Message-ID: <000a01c274c7$66c90840$204c3ed2@PTN>
This is a multi-part message in MIME format.
------=_NextPart_000_0007_01C2750A.74D6C470
Content-Type: text/plain;
charset="big5"
Content-Transfer-Encoding: quoted-printable
dear all:
I try to download from http://www.biopython.org/Download/
,but it can't get link.
Is it ok ?
Thanks a lot!
This is kenny
------=_NextPart_000_0007_01C2750A.74D6C470
Content-Type: text/html;
charset="big5"
Content-Transfer-Encoding: quoted-printable
dear =
all:
I try to download =
from http://www.biopython.org/Down=
load/
,but it can't get =
link.
Is it ok ?
Thanks a lot!
This is =
kenny
------=_NextPart_000_0007_01C2750A.74D6C470--
From jchang@smi.stanford.edu Wed Oct 16 06:23:48 2002
From: jchang@smi.stanford.edu (Jeffrey Chang)
Date: Tue, 15 Oct 2002 22:23:48 -0700
Subject: [BioPython] download
In-Reply-To: <000a01c274c7$66c90840$204c3ed2@PTN>; from dna106@nhri.org.tw on Wed, Oct 16, 2002 at 11:52:09AM +0800
References: <000a01c274c7$66c90840$204c3ed2@PTN>
Message-ID: <20021015222348.A39265@springfield.stanford.edu>
Hi Kenny,
There have been a lot of network changes in the last week or so, so
it's possible something got broken in the move. I'll check on it
tomorrow. Sorry about the inconvenience.
Jeff
On Wed, Oct 16, 2002 at 11:52:09AM +0800, dna106 wrote:
> dear all:
> I try to download from http://www.biopython.org/Download/
> ,but it can't get link.
> Is it ok ?
> Thanks a lot!
>
> This is kenny
From jchang@smi.stanford.edu Thu Oct 17 04:28:44 2002
From: jchang@smi.stanford.edu (Jeffrey Chang)
Date: Wed, 16 Oct 2002 20:28:44 -0700
Subject: [BioPython] download
In-Reply-To: <000a01c274c7$66c90840$204c3ed2@PTN>; from dna106@nhri.org.tw on Wed, Oct 16, 2002 at 11:52:09AM +0800
References: <000a01c274c7$66c90840$204c3ed2@PTN>
Message-ID: <20021016202844.C42456@springfield.stanford.edu>
Things should be working again. Please let me know if there are any
further problems.
Jeff
On Wed, Oct 16, 2002 at 11:52:09AM +0800, dna106 wrote:
> dear all:
> I try to download from http://www.biopython.org/Download/
> ,but it can't get link.
> Is it ok ?
> Thanks a lot!
>
> This is kenny
From pobrien@orbtech.com Fri Oct 18 14:53:30 2002
From: pobrien@orbtech.com (Patrick K. O'Brien)
Date: Fri, 18 Oct 2002 08:53:30 -0500
Subject: [BioPython] Python for Bioinformatics article
Message-ID: <200210180853.30366.pobrien@orbtech.com>
I'd like to thank everyone on this list that reviewed my Beginning Python for
Bioinformatics article. Your feedback was very helpful, even when I wasn't
able to incorporate every suggestion. I do hope the article helps expose more
bioinformatics folks to my favorite language. You can see the final,
published version on the O'Reilly website:
http://www.onlamp.com/pub/a/python/2002/10/17/biopython.html
Thanks again,
Pat
--
Patrick K. O'Brien
Orbtech http://www.orbtech.com/web/pobrien
-----------------------------------------------
"Your source for Python programming expertise."
-----------------------------------------------
From prentum@prentum.com Sun Oct 20 18:00:40 2002
From: prentum@prentum.com (prentum@prentum.com)
Date: Mon, 21 Oct 2002 01:00:40 +0800
Subject: [BioPython] Comfortable Insoles of Palm Fibers
Message-ID: <200210201556.g9KFu54Q012133@pw600a.bioperl.org>
Insoles of Palm Fibers
Good Day!
We supply insoles of palm fibers. The
insoles are made with natural palm fibers, can offer ventilation and prevents athlete's foot
& stink very good, and let the feet are much comfortable.
This insole product is very much applauded in every country, don't hesitate to
contact us if you are interested to purchase insoles of palm fibers from China,
we
will quote you CIF price as soon as you tell us your port of destination and order
quantity.
You can view the photo of the insole of
palm fibers by go to: www.prentum.com/zxd.jpg
Best regards
Mr. Long Tan
Prentum Development Corp.
China
===============================================================
该邮件使用 科特邮件群发软件 发送,邮件内容与科特软件无关
科特软件 http://www.caretop.com
===============================================================
From Ravinder.Singh@colorado.edu Tue Oct 22 16:16:51 2002
From: Ravinder.Singh@colorado.edu (Ravinder Singh)
Date: Tue, 22 Oct 2002 09:16:51 -0600
Subject: [BioPython] Promotional Ads
Message-ID: <3DB56BDC.3B39213B@colorado.edu>
Dear Biopython community,
I hope most of us agree that in today's world there is no dearth of
getting unsolicited ads or e-mails. When I joined the biopython's
mailing list, I didn't anticipate that my subscribing to this will open
yet another door to receive junk mail; I'm referring to for example
those advertising Shoe soles etc. from China. Of course, I enjoy being
part of the biopython community, but I'd appreciate if I could be saved
from unnecessary advertising..
Many thanks if you are able to do something about it.
Ravinder
--
********************************************************************************
Dr. Ravinder Singh
Assistant Professor
MCD Biology
347 UCB
University of Colorado
Boulder, CO 80309-0347
(303)492-8886 (voice)
(303)492-7744 (fax)
From djewell@Dartmouth.EDU Tue Oct 22 16:31:24 2002
From: djewell@Dartmouth.EDU (David A. Jewell)
Date: 22 Oct 2002 11:31:24 EDT
Subject: [BioPython] Promotional Ads
Message-ID: <394174@bambi.Dartmouth.EDU>
Dr. Singh sentiments are my own and I would very much appreciate
efforts in securing the Bio-python server from what appears
to be frequent hacks.
Thank you,
David Jewell
Research Computing
Dartmouth College
--- Ravinder Singh wrote:
Dear Biopython community,
I hope most of us agree that in today's world there is no dearth of
getting unsolicited ads or e-mails. When I joined the biopython's
mailing list, I didn't anticipate that my subscribing to this will open
yet another door to receive junk mail; I'm referring to for example
those advertising Shoe soles etc. from China. Of course, I enjoy being
part of the biopython community, but I'd appreciate if I could be saved
from unnecessary advertising..
Many thanks if you are able to do something about it.
Ravinder
--- end of quote ---
From dyoo@hkn.eecs.berkeley.edu Tue Oct 22 18:17:33 2002
From: dyoo@hkn.eecs.berkeley.edu (Danny Yoo)
Date: Tue, 22 Oct 2002 10:17:33 -0700 (PDT)
Subject: [BioPython] Promotional Ads
In-Reply-To: <394174@bambi.Dartmouth.EDU>
Message-ID:
On 22 Oct 2002, David A. Jewell wrote:
> Dr. Singh sentiments are my own and I would very much appreciate efforts
> in securing the Bio-python server from what appears to be frequent
> hacks.
How about if the biopython lists are restricted so that only subscribers
can post? This is the approach that many other Mailman mailing lists have
taken to prevent junk mail from flooding the list.
It's also extraordinarily disheartening when there's more spam than actual
bug reports in Jitterbug; I personally almost despise getting mail from
biopython-dev simply because it's spam for the most part!
The mailing lists on mail.python.org also have a spam filter that seems to
be fairly effective. Someone may want to contact the mail.python.org
administrator and see if a similar system can be set up for Biopython.org.
From dag@sonsorol.org Tue Oct 22 18:28:20 2002
From: dag@sonsorol.org (Chris Dagdigian)
Date: Tue, 22 Oct 2002 13:28:20 -0400
Subject: [BioPython] Promotional Ads
In-Reply-To:
References:
Message-ID: <3DB58AB4.4050004@sonsorol.org>
These complaints should have been sent to the OBF sysadmin team
(root-l@bioperl.org) so we could have responded. I can't subsribe to
every one of our 35+ lists you know :)
I've set up more restrictive anti-spam rules within Mailman for both the
bioperl and biojava mailing lists. The lists still allow outsiders to
post but we hold-for-moderation all emails that are not mime-encoded as
text/plain and any emails that include attachments. This works very well
but places an administrative burden on our volunteer mailing list
moderators.
The BioMoby list has taken this even futher-- they have elected to close
the list to outside posters -- all posts from non-members are held for
moderation and the moby list members have stepped forward to handle the
moderation tasks.
We also subscribe on a server level to the http:///mail-abuse.org RBL+
blackhole list which allows us to refuse inbound SMTP connections from
IP addresses of known spammers or open relays. Sadly this filter has not
worked since we changed IP addresses a few weeks ago. We have an open
ticket in with mail-abuse.org to update their databse with our new IP.
So- please discuss amongst yourselves what additional steps you'd like
to take. I'd recommend trying to block all attachments and non-plaintext
emails before taking the more drastic step of taking the list private.
It would also help greatly if there were a member or two on this list
who would volunteer to join our mailteam to help with the increased
moderation duties.
Regarding jitterbug -- you can elect to disable the email-based bug
reporting or you can switch to Bugzilla as bioperl did. In fact I think
Jeff has already set up bugzilla for biopython?
Regards,
Chris
Open-Bio.org
Danny Yoo wrote:
>On 22 Oct 2002, David A. Jewell wrote:
>
>
>
>>Dr. Singh sentiments are my own and I would very much appreciate efforts
>>in securing the Bio-python server from what appears to be frequent
>>hacks.
>>
>>
>
>
>How about if the biopython lists are restricted so that only subscribers
>can post? This is the approach that many other Mailman mailing lists have
>taken to prevent junk mail from flooding the list.
>
>It's also extraordinarily disheartening when there's more spam than actual
>bug reports in Jitterbug; I personally almost despise getting mail from
>biopython-dev simply because it's spam for the most part!
>
>
>The mailing lists on mail.python.org also have a spam filter that seems to
>be fairly effective. Someone may want to contact the mail.python.org
>administrator and see if a similar system can be set up for Biopython.org.
>
>
From jmfreeman@attbi.com Thu Oct 24 12:46:20 2002
From: jmfreeman@attbi.com (James Freeman)
Date: Thu, 24 Oct 2002 07:46:20 -0400
Subject: [BioPython] Promotional Ads
References: <3DB58AB4.4050004@sonsorol.org>
Message-ID: <3DB7DD8C.1090301@attbi.com>
Hi Chris,
If they take the DAS route, members only, with non member mail being
cleared by a several volunteer spam filters (I am one of four volunteers
for DAS). The spam goes to nothing, I can't block a valid mail without
all the other mail admins knowing about it. A couple of minutes a day
is all that is needed. The DAS lists spam has dropped to nothing since
then, and I have sent through several pieces of relevant non-member
mail. So if they do that sign me up.
Warmest Regards,
Jim Freeman
Bioinformatics Consultant At Biogen
Chris Dagdigian wrote:
>
> These complaints should have been sent to the OBF sysadmin team
> (root-l@bioperl.org) so we could have responded. I can't subsribe to
> every one of our 35+ lists you know :)
>
> I've set up more restrictive anti-spam rules within Mailman for both
> the bioperl and biojava mailing lists. The lists still allow outsiders
> to post but we hold-for-moderation all emails that are not
> mime-encoded as text/plain and any emails that include attachments.
> This works very well but places an administrative burden on our
> volunteer mailing list moderators.
>
> The BioMoby list has taken this even futher-- they have elected to
> close the list to outside posters -- all posts from non-members are
> held for moderation and the moby list members have stepped forward to
> handle the moderation tasks.
>
> We also subscribe on a server level to the http:///mail-abuse.org RBL+
> blackhole list which allows us to refuse inbound SMTP connections from
> IP addresses of known spammers or open relays. Sadly this filter has
> not worked since we changed IP addresses a few weeks ago. We have an
> open ticket in with mail-abuse.org to update their databse with our
> new IP.
>
> So- please discuss amongst yourselves what additional steps you'd like
> to take. I'd recommend trying to block all attachments and
> non-plaintext emails before taking the more drastic step of taking
> the list private. It would also help greatly if there were a member or
> two on this list who would volunteer to join our mailteam to help with
> the increased moderation duties.
>
> Regarding jitterbug -- you can elect to disable the email-based bug
> reporting or you can switch to Bugzilla as bioperl did. In fact I
> think Jeff has already set up bugzilla for biopython?
>
> Regards,
> Chris
> Open-Bio.org
>
>
>
> Danny Yoo wrote:
>
>> On 22 Oct 2002, David A. Jewell wrote:
>>
>>
>>
>>> Dr. Singh sentiments are my own and I would very much appreciate
>>> efforts
>>> in securing the Bio-python server from what appears to be frequent
>>> hacks.
>>>
>>
>>
>>
>> How about if the biopython lists are restricted so that only subscribers
>> can post? This is the approach that many other Mailman mailing lists
>> have
>> taken to prevent junk mail from flooding the list.
>>
>> It's also extraordinarily disheartening when there's more spam than
>> actual
>> bug reports in Jitterbug; I personally almost despise getting mail from
>> biopython-dev simply because it's spam for the most part!
>>
>>
>> The mailing lists on mail.python.org also have a spam filter that
>> seems to
>> be fairly effective. Someone may want to contact the mail.python.org
>> administrator and see if a similar system can be set up for
>> Biopython.org.
>>
>>
>
>
> _______________________________________________
> BioPython mailing list - BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython
>
From andreas.kuntzagk@mdc-berlin.de Thu Oct 24 15:18:30 2002
From: andreas.kuntzagk@mdc-berlin.de (Andreas Kuntzagk)
Date: 24 Oct 2002 16:18:30 +0200
Subject: [BioPython] GenBank.FeatureParser and multiple accessionnumbers
Message-ID: <1035469109.19071.9.camel@tahiti>
Hi,
at the moment the GenBank.FeatureParser stores only the first accession
number of an entry. (right?)
Would it make sense to store all of them? (e.g. as an annotation)
I would like to search a dictionary of SeqRecords by an accession
number.
ciao, Andreas "murple" Kuntzagk
--
Andreas Kuntzagk
From jchang@smi.stanford.edu Fri Oct 25 00:37:05 2002
From: jchang@smi.stanford.edu (Jeffrey Chang)
Date: Thu, 24 Oct 2002 16:37:05 -0700
Subject: [BioPython] GenBank.FeatureParser and multiple accessionnumbers
In-Reply-To: <1035469109.19071.9.camel@tahiti>; from andreas.kuntzagk@mdc-berlin.de on Thu, Oct 24, 2002 at 04:18:30PM +0200
References: <1035469109.19071.9.camel@tahiti>
Message-ID: <20021024163704.M65276@springfield.stanford.edu>
I agree. Perhaps the first accession number should be seq.id, and
*all* the accessions (including the first one) should be an annotation
like seq.annotations["accessions"]. They certainly should be
accessible.
How does bioperl handle this?
Jeff
On Thu, Oct 24, 2002 at 04:18:30PM +0200, Andreas Kuntzagk wrote:
> Hi,
>
> at the moment the GenBank.FeatureParser stores only the first accession
> number of an entry. (right?)
> Would it make sense to store all of them? (e.g. as an annotation)
> I would like to search a dictionary of SeqRecords by an accession
> number.
>
> ciao, Andreas "murple" Kuntzagk
>
> --
> Andreas Kuntzagk
>
> _______________________________________________
> BioPython mailing list - BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython
From jason@cgt.mc.duke.edu Fri Oct 25 13:20:58 2002
From: jason@cgt.mc.duke.edu (Jason Stajich)
Date: Fri, 25 Oct 2002 08:20:58 -0400 (EDT)
Subject: [BioPython] GenBank.FeatureParser and multiple accessionnumbers
In-Reply-To: <20021024163704.M65276@springfield.stanford.edu>
Message-ID:
On Thu, 24 Oct 2002, Jeffrey Chang wrote:
> I agree. Perhaps the first accession number should be seq.id, and
> *all* the accessions (including the first one) should be an annotation
> like seq.annotations["accessions"]. They certainly should be
> accessible.
>
> How does bioperl handle this?
>
separate methods for declared 'RichSequences' (GenBank/EMBL/SwissProt
parser produce these which have a richer interface than basic sequences
with features).
In our case we have
get_secondary_accessions() which returns a list of accessions
to distinguish primary from secondary accessions.
> Jeff
>
>
> On Thu, Oct 24, 2002 at 04:18:30PM +0200, Andreas Kuntzagk wrote:
> > Hi,
> >
> > at the moment the GenBank.FeatureParser stores only the first accession
> > number of an entry. (right?)
> > Would it make sense to store all of them? (e.g. as an annotation)
> > I would like to search a dictionary of SeqRecords by an accession
> > number.
> >
> > ciao, Andreas "murple" Kuntzagk
> >
> > --
> > Andreas Kuntzagk
> >
> > _______________________________________________
> > BioPython mailing list - BioPython@biopython.org
> > http://biopython.org/mailman/listinfo/biopython
> _______________________________________________
> BioPython mailing list - BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython
>
--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From sbassi@asalup.org Fri Oct 25 16:56:08 2002
From: sbassi@asalup.org (Sebastian Bassi)
Date: Fri, 25 Oct 2002 12:56:08 -0300
Subject: [BioPython] Running local blast with aa
Message-ID: <3DB96998.8070705@asalup.org>
Hello,
I have a problem I think is a Python problem since when I trie to do it
manually with the blast executable it works.
I磎 running local BLAST (the standalone version under WinNT).
I did the test on the blast readme file and went OK. (the test was to
blastn a ecoli sequence)
Then I tried to blastX an ecoli nucleitide sequence against the ecoli.aa
database (I did formated the ecolia.aa with formatdb of course). The
nucleotide sequence I used to test was:
>test de prot
TATGAGCATACTTTGATGGCTTTGGAGGCTGGTTGTCATGTTATGTGTGAGAAGCCTCCTGCTATGACTCCTGAGCAGGC
TCGTGAGATGTGTGATACTGCTCGTAAGTTGGGTAAGGTTTTGGCTTATGATTTTCATCATCGTTTTGCTTTGGATACTC
AGCAGTTGCGTGAGCAGGTTACTAATGGTGTTTTGGGTGAGATTTATGTTACTACTGCTCGTGCT
This is a backtranslation from a part of an actual ecoli protein
(AAC74397). (was backtranslated with python using table bacterial table,
11)
When I run this blast on the NCBI site, I get the original protein as a
first hit (AAC74397). When I do it locally from the command line BLAST
it also works fine.
But the problem is that when I do it locally using Python (I mean, the
blastX against the ecoli.aa database) I get 0 hits. I磎 using all
standard/default values.
Here磗 the output I get:
BLASTX 2.2.4 [Aug-26-2002]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= test de prot
(225 letters)
Database: //server/bioinfo/blast/data/ecoli.aa
4289 sequences; 1,358,990 total letters
***** No hits found ******
Database: //server/bioinfo/blast/data/ecoli.aa
Posted date: Oct 25, 2002 8:30 AM
Number of letters in database: 1,358,990
Number of sequences in database: 4289
If you want to see my input file:
>test de prot
TATGAGCATACTTTGATGGCTTTGGAGGCTGGTTGTCATGTTATGTGTGAGAAGCCTCCTGCTATGACTC
CTGAGCAGGCTCGTGAGATGTGTGATACTGCTCGTAAGTTGGGTAAGGTTTTGGCTTATGATTTTCATCA
TCGTTTTGCTTTGGATACTCAGCAGTTGCGTGAGCAGGTTACTAATGGTGTTTTGGGTGAGATTTATGTT
ACTACTGCTCGTGCT
And here is my little python program (BTW, it works fine for blastn, so
I asume the program logic is OK).
from Bio.Blast import NCBIStandalone
import os
import string
import re
pathdb="//server/bioinfo/blast/data/ecoli.aa"
blastexe="//server/bioinfo/blast/blastall.exe"
pathin="D:\\projects\\bioinfo-adv\\set-cd-small\\"
filesentr="D:\\projects\\bioinfo-adv\\set-cd-small"
pathout="blastbatch\\outblast"
print "OK 1"
cont = 0
# mando todos los files de set-cd-complete a una lista
listaentrada=os.listdir(filesentr)
for x in listaentrada:
cont = cont + 1
blast_out, error_info = NCBIStandalone.blastall(blastexe, 'blastx',
pathdb, pathin+x)
salida=open(pathout+x+".txt","w")
salida.writelines(blast_out)
salida.close()
print "Blast numero "+`cont`+" "+x
print "FIN"
print "OK 2 re ok"
From jchang@smi.stanford.edu Fri Oct 25 19:49:46 2002
From: jchang@smi.stanford.edu (Jeffrey Chang)
Date: Fri, 25 Oct 2002 11:49:46 -0700
Subject: [BioPython] Running local blast with aa
In-Reply-To: <3DB96998.8070705@asalup.org>; from sbassi@asalup.org on Fri, Oct 25, 2002 at 12:56:08PM -0300
References: <3DB96998.8070705@asalup.org>
Message-ID: <20021025114946.A68622@springfield.stanford.edu>
Hi Sebastian,
Let me see if I got this correct. You have a sequence that you're
using to BLAST against a database. If you run it by hand using local
BLAST, you get some hits back. However, if you run it from Biopython,
you're getting no hits back.
This would be very unusual because biopython does not do any
interpretation on the inputs or outputs to BLAST. It just calls it
and returns whatever the program prints. Are you sure that you're
calling it with the same parameters? For example, is one of them
filtered for low complexity sequences?
To see how the program is getting called in biopython, insert a line
into NCBIStandalone.py:
for attr in keywds.keys():
params.extend([att2param[attr], str(keywds[attr])])
--> print repr(params)
r, w, e = popen2.popen3(' '.join([blastcmd] + params))
w.close()
Jeff
On Fri, Oct 25, 2002 at 12:56:08PM -0300, Sebastian Bassi wrote:
> Hello,
>
> I have a problem I think is a Python problem since when I trie to do it
> manually with the blast executable it works.
> I磎 running local BLAST (the standalone version under WinNT).
> I did the test on the blast readme file and went OK. (the test was to
> blastn a ecoli sequence)
> Then I tried to blastX an ecoli nucleitide sequence against the ecoli.aa
> database (I did formated the ecolia.aa with formatdb of course). The
> nucleotide sequence I used to test was:
> >test de prot
> TATGAGCATACTTTGATGGCTTTGGAGGCTGGTTGTCATGTTATGTGTGAGAAGCCTCCTGCTATGACTCCTGAGCAGGC
> TCGTGAGATGTGTGATACTGCTCGTAAGTTGGGTAAGGTTTTGGCTTATGATTTTCATCATCGTTTTGCTTTGGATACTC
> AGCAGTTGCGTGAGCAGGTTACTAATGGTGTTTTGGGTGAGATTTATGTTACTACTGCTCGTGCT
> This is a backtranslation from a part of an actual ecoli protein
> (AAC74397). (was backtranslated with python using table bacterial table,
> 11)
> When I run this blast on the NCBI site, I get the original protein as a
> first hit (AAC74397). When I do it locally from the command line BLAST
> it also works fine.
> But the problem is that when I do it locally using Python (I mean, the
> blastX against the ecoli.aa database) I get 0 hits. I磎 using all
> standard/default values.
> Here磗 the output I get:
>
> BLASTX 2.2.4 [Aug-26-2002]
>
>
> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
> programs", Nucleic Acids Res. 25:3389-3402.
>
> Query= test de prot
> (225 letters)
>
> Database: //server/bioinfo/blast/data/ecoli.aa
> 4289 sequences; 1,358,990 total letters
>
>
>
> ***** No hits found ******
>
> Database: //server/bioinfo/blast/data/ecoli.aa
> Posted date: Oct 25, 2002 8:30 AM
> Number of letters in database: 1,358,990
> Number of sequences in database: 4289
>
> If you want to see my input file:
>
> >test de prot
> TATGAGCATACTTTGATGGCTTTGGAGGCTGGTTGTCATGTTATGTGTGAGAAGCCTCCTGCTATGACTC
> CTGAGCAGGCTCGTGAGATGTGTGATACTGCTCGTAAGTTGGGTAAGGTTTTGGCTTATGATTTTCATCA
> TCGTTTTGCTTTGGATACTCAGCAGTTGCGTGAGCAGGTTACTAATGGTGTTTTGGGTGAGATTTATGTT
> ACTACTGCTCGTGCT
>
> And here is my little python program (BTW, it works fine for blastn, so
> I asume the program logic is OK).
>
>
> from Bio.Blast import NCBIStandalone
> import os
> import string
> import re
>
> pathdb="//server/bioinfo/blast/data/ecoli.aa"
> blastexe="//server/bioinfo/blast/blastall.exe"
> pathin="D:\\projects\\bioinfo-adv\\set-cd-small\\"
> filesentr="D:\\projects\\bioinfo-adv\\set-cd-small"
> pathout="blastbatch\\outblast"
>
> print "OK 1"
> cont = 0
>
> # mando todos los files de set-cd-complete a una lista
>
> listaentrada=os.listdir(filesentr)
> for x in listaentrada:
> cont = cont + 1
> blast_out, error_info = NCBIStandalone.blastall(blastexe, 'blastx',
> pathdb, pathin+x)
> salida=open(pathout+x+".txt","w")
> salida.writelines(blast_out)
> salida.close()
> print "Blast numero "+`cont`+" "+x
> print "FIN"
>
> print "OK 2 re ok"
>
>
> _______________________________________________
> BioPython mailing list - BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython
From carlo_bif@yahoo.com Fri Oct 25 19:59:06 2002
From: carlo_bif@yahoo.com (Carlo Bifulco)
Date: Fri, 25 Oct 2002 20:59:06 +0200
Subject: [BioPython] Running local blast with aa
References: <3DB96998.8070705@asalup.org>
Message-ID: <3DB9947A.8070004@yahoo.com>
Hi Sebastian,
I think that the problem you having is due to the fact that when in your
code you do:
blast_out, error_info = NCBIStandalone.blastall(blastexe, 'blastx',
pathdb, pathin+x)
what you actually get as blast_out is a file handle and not a string.
That's probably why
salida.writelines(blast_out)
doesn't go anywhere.
A simple fix could be replacing it with:
salida.write(blast_out.read()) # not tested !
Regards,
Carlo Bifulco, MD
Sebastian Bassi wrote:
> Hello,
>
> I have a problem I think is a Python problem since when I trie to do it
> manually with the blast executable it works.
> I磎 running local BLAST (the standalone version under WinNT).
> I did the test on the blast readme file and went OK. (the test was to
> blastn a ecoli sequence)
> Then I tried to blastX an ecoli nucleitide sequence against the ecoli.aa
> database (I did formated the ecolia.aa with formatdb of course). The
> nucleotide sequence I used to test was:
> >test de prot
> TATGAGCATACTTTGATGGCTTTGGAGGCTGGTTGTCATGTTATGTGTGAGAAGCCTCCTGCTATGACTCCTGAGCAGGC
>
> TCGTGAGATGTGTGATACTGCTCGTAAGTTGGGTAAGGTTTTGGCTTATGATTTTCATCATCGTTTTGCTTTGGATACTC
>
> AGCAGTTGCGTGAGCAGGTTACTAATGGTGTTTTGGGTGAGATTTATGTTACTACTGCTCGTGCT
> This is a backtranslation from a part of an actual ecoli protein
> (AAC74397). (was backtranslated with python using table bacterial table,
> 11)
> When I run this blast on the NCBI site, I get the original protein as a
> first hit (AAC74397). When I do it locally from the command line BLAST
> it also works fine.
> But the problem is that when I do it locally using Python (I mean, the
> blastX against the ecoli.aa database) I get 0 hits. I磎 using all
> standard/default values.
> Here磗 the output I get:
>
> BLASTX 2.2.4 [Aug-26-2002]
>
>
> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
> programs", Nucleic Acids Res. 25:3389-3402.
>
> Query= test de prot
> (225 letters)
>
> Database: //server/bioinfo/blast/data/ecoli.aa
> 4289 sequences; 1,358,990 total letters
>
>
>
> ***** No hits found ******
>
> Database: //server/bioinfo/blast/data/ecoli.aa
> Posted date: Oct 25, 2002 8:30 AM
> Number of letters in database: 1,358,990
> Number of sequences in database: 4289
>
> If you want to see my input file:
>
> >test de prot
> TATGAGCATACTTTGATGGCTTTGGAGGCTGGTTGTCATGTTATGTGTGAGAAGCCTCCTGCTATGACTC
> CTGAGCAGGCTCGTGAGATGTGTGATACTGCTCGTAAGTTGGGTAAGGTTTTGGCTTATGATTTTCATCA
> TCGTTTTGCTTTGGATACTCAGCAGTTGCGTGAGCAGGTTACTAATGGTGTTTTGGGTGAGATTTATGTT
> ACTACTGCTCGTGCT
>
> And here is my little python program (BTW, it works fine for blastn, so
> I asume the program logic is OK).
>
>
> from Bio.Blast import NCBIStandalone
> import os
> import string
> import re
>
> pathdb="//server/bioinfo/blast/data/ecoli.aa"
> blastexe="//server/bioinfo/blast/blastall.exe"
> pathin="D:\\projects\\bioinfo-adv\\set-cd-small\\"
> filesentr="D:\\projects\\bioinfo-adv\\set-cd-small"
> pathout="blastbatch\\outblast"
>
> print "OK 1"
> cont = 0
>
> # mando todos los files de set-cd-complete a una lista
>
> listaentrada=os.listdir(filesentr)
> for x in listaentrada:
> cont = cont + 1
> blast_out, error_info = NCBIStandalone.blastall(blastexe, 'blastx',
> pathdb, pathin+x)
> salida=open(pathout+x+".txt","w")
> salida.writelines(blast_out)
> salida.close()
> print "Blast numero "+`cont`+" "+x
> print "FIN"
>
> print "OK 2 re ok"
>
>
> _______________________________________________
> BioPython mailing list - BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython
>
From sbassi@asalup.org Sat Oct 26 03:08:40 2002
From: sbassi@asalup.org (Sebastian Bassi)
Date: Fri, 25 Oct 2002 23:08:40 -0300
Subject: [BioPython] Running local blast (Problem solved!)
Message-ID: <3DB9F928.3000603@asalup.org>
Hi,
Now it works! I really don磘 know why, because I changed so many things
at once, I don磘 know wich change made it works.
I will post now the working version if someone is interested in picking
up the difference(s). I won磘 do it because I磎 tired of debugging my
programs and now that it works its time to look at the results!
Thank to everybody. I will stay here since I have a lot to learn on
Python an BioPython.
Here is the program:
# BATCH BLAST. By Sebastian Bassi for Advanta Seeds.
from Bio.Blast import NCBIStandalone
import os
import string
import re
pathdb="d:\\projects\\bioinfo-adv\\blast\\data\\atal.faa"
blastexe="d:\\projects\\bioinfo-adv\\blast\\blastall.exe"
pathin="D:\\projects\\bioinfo-adv\\set-cd-small\\"
filesentr="D:\\projects\\bioinfo-adv\\set-cd-small"
pathout="blastbatch\\out"
print "OK 1"
cont = 0
# mando todos los files de set-cd-complete a una lista
listaentrada=os.listdir(filesentr)
for x in listaentrada:
cont = cont + 1
blast_out, error_info = NCBIStandalone.blastall(blastexe, 'blastx',
pathdb, pathin+x)
salida=open(pathout+x+".blasted.txt","w")
salida.writelines(blast_out)
salida.close()
print "Blast numero "+`cont`+" "+x
print "FIN"
print "OK 2 re ok"
--
Best regards,
//=\ Sebastian Bassi - Diplomado en Ciencia y Tecnologia, UNQ //=\
\=// IT Manager Advanta Seeds - Balcarce Research Center - \=//
//=\ Pro secretario ASALUP - www.asalup.org - PGP key available //=\
\=// E-mail: sbassi@genesdigitales.com - ICQ UIN: 3356556 - \=//
ASALUP investiga: http://argentinaworks.asalup.org
From carlo_bif@yahoo.com Sun Oct 27 12:35:04 2002
From: carlo_bif@yahoo.com (Carlo Bifulco)
Date: Sun, 27 Oct 2002 13:35:04 +0100
Subject: [BioPython] Running local blast with aa
References: <3DB96998.8070705@asalup.org> <3DB9947A.8070004@yahoo.com> <3DB9F024.3050700@asalup.org>
Message-ID: <3DBBDD78.5000809@yahoo.com>
Hi folks:
My previous suggestion was wrong. I had a misconception about how the
file method writelines works. The argument can actually be any iterable
object producing strings, therefore it was not responsible of the
failure of the original version of Sebastian's script.
Regards,
Carlo
From tbacomps@bigpond.net.au Mon Oct 28 01:42:24 2002
From: tbacomps@bigpond.net.au (Timothy Badenach)
Date: Mon, 28 Oct 2002 12:42:24 +1100
Subject: [BioPython] RE: BioPython digest, Vol 1 #435 - 1 msg
In-Reply-To: <20021027170001.26242.83627.Mailman@pw600a.bioperl.org>
Message-ID: <000701c27e23$43d47f30$0100000a@TBA1>
-----Original Message-----
From: biopython-admin@biopython.org
[mailto:biopython-admin@biopython.org] On Behalf Of
biopython-request@biopython.org
Sent: Monday, October 28, 2002 4:00 AM
To: biopython@biopython.org
Subject: BioPython digest, Vol 1 #435 - 1 msg
Send BioPython mailing list submissions to
biopython@biopython.org
To subscribe or unsubscribe via the World Wide Web, visit
http://biopython.org/mailman/listinfo/biopython
or, via email, send a message with subject or body 'help' to
biopython-request@biopython.org
You can reach the person managing the list at
biopython-admin@biopython.org
When replying, please edit your Subject line so it is more specific
than "Re: Contents of BioPython digest..."
Today's Topics:
1. Re: Running local blast with aa (Carlo Bifulco)
--__--__--
Message: 1
Date: Sun, 27 Oct 2002 13:35:04 +0100
From: Carlo Bifulco
To: biopython
Subject: Re: [BioPython] Running local blast with aa
Hi folks:
My previous suggestion was wrong. I had a misconception about how the
file method writelines works. The argument can actually be any iterable
object producing strings, therefore it was not responsible of the
failure of the original version of Sebastian's script.
Regards,
Carlo
--__--__--
_______________________________________________
BioPython mailing list - BioPython@biopython.org
http://biopython.org/mailman/listinfo/biopython
End of BioPython Digest
From sugino@brandeis.edu Thu Oct 31 21:33:20 2002
From: sugino@brandeis.edu (Ken Sugino)
Date: Thu, 31 Oct 2002 16:33:20 -0500
Subject: [BioPython] Re: BioPython -- confirmation of subscription -- request 820429
In-Reply-To: <20021031175632.5101.2182.Mailman@pw600a.bioperl.org>
References: <20021031175632.5101.2182.Mailman@pw600a.bioperl.org>
Message-ID: <20021031163320.323a980f.sugino@brandeis.edu>
On Thu, 31 Oct 2002 12:56:32 -0500
biopython-request@biopython.org wrote:
> BioPython -- confirmation of subscription -- request 820429
>
> We have received a request from egret.bio.brandeis.edu for
> subscription of your email address, , to the
> biopython@biopython.org mailing list. To confirm the request, please
> send a message to biopython-request@biopython.org, and either:
>
> - maintain the subject line as is (the reply's additional "Re:" is
> ok),
>
> - or include the following line - and only the following line - in the
> message body:
>
> confirm 820429
>
> (Simply sending a 'reply' to this message should work from most email
> interfaces, since that usually leaves the subject line in the right
> form.)
>
> If you do not wish to subscribe to this list, please simply disregard
> this message. Send questions to biopython-admin@biopython.org.
From idoerg@burnham.org Thu Oct 31 22:00:51 2002
From: idoerg@burnham.org (Iddo Friedberg)
Date: Thu, 31 Oct 2002 14:00:51 -0800
Subject: [BioPython] pairwise alignment
References:
Message-ID: <3DC1A813.2040108@burnham.org>
Hi,
Do we have a pairwise alignment module which can use scoring matrices? I
only know of Bio.pairwise2 which uses a match/mismatch scoring scheme.
Thanks,
Iddo
--
Iddo Friedberg
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037
USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 646 3171
From jchang@smi.stanford.edu Thu Oct 31 22:29:46 2002
From: jchang@smi.stanford.edu (Jeffrey Chang)
Date: Thu, 31 Oct 2002 14:29:46 -0800
Subject: [BioPython] pairwise alignment
In-Reply-To: <3DC1A813.2040108@burnham.org>; from idoerg@burnham.org on Thu, Oct 31, 2002 at 02:00:51PM -0800
References: <3DC1A813.2040108@burnham.org>
Message-ID: <20021031142945.A86646@springfield.stanford.edu>
Yes, pairwise2 can handle this. You can pass in dictionary whose keys
are tuples of letters, e.g. ("V", "I"), and returns its match score.
The module is actually very flexible in terms of what kinds of
parameters it accepts for the match scores and gap penalties. The
documentation could probably be clearer, though...
Jeff
On Thu, Oct 31, 2002 at 02:00:51PM -0800, Iddo Friedberg wrote:
> Hi,
>
> Do we have a pairwise alignment module which can use scoring matrices? I
> only know of Bio.pairwise2 which uses a match/mismatch scoring scheme.
>
> Thanks,
>
> Iddo
>
> --
> Iddo Friedberg
> The Burnham Institute
> 10901 N. Torrey Pines Rd.
> La Jolla, CA 92037
> USA
> Tel: +1 (858) 646 3100 x3516
> Fax: +1 (858) 646 3171
>
>
> _______________________________________________
> BioPython mailing list - BioPython@biopython.org
> http://biopython.org/mailman/listinfo/biopython
