[BioPython] SyntaxError: Line does not start with '>': .....

[Francois-regis Chalaoux]

Hi,

Trying to extract information from fasta records I got an error.

I can avoid this error when I insert a blank line between each record but when I download a ncbi fasta file, it does not contain blank line between records by default !!

Is it a bug in BioPython, should I implement myself 'end_sequence()', Is there a bug in my program ?

Read you soon, FR.

==========
fasta_ex.py
==========
import string
from Bio.ParserSupport import AbstractConsumer

class TitleSearchConsumer(AbstractConsumer):
    def title(self, line):
        # see if the title contains a reference to humans
        location = string.find(line, "Homo sapiens")
        
        if location != -1:
            # split the string to give us the accession number
            result = string.split(line, '|')
            print 'Accession:', result[3]

# set up the scanner, consumer and file to parse
from Bio import Fasta
scanner = Fasta._Scanner()
consumer = TitleSearchConsumer()

file = open('U:??python??biopython??taxol2.fasta', 'r')
# parse all fasta records in the file

for n in range(55):
    scanner.feed(file, consumer)

file.close()    

==========
Traceback 
==========
Traceback (most recent call last):
  File "E:?softwares?Python21?Pythonwin?pywin?framework?scriptutils.py", line 298, in RunScript
    debugger.run(codeObject, __main__.__dict__, start_stepping=0)
  File "E:?softwares?Python21?Pythonwin?pywin?debugger?__init__.py", line 60, in run
    _GetCurrentDebugger().run(cmd, globals,locals, start_stepping)
  File "E:?softwares?Python21?Pythonwin?pywin?debugger?debugger.py", line 582, in run
    _doexec(cmd, globals, locals)
  File "E:?softwares?Python21?Pythonwin?pywin?debugger?debugger.py", line 924, in _doexec
    exec cmd in globals, locals
  File "U:?python?biopython?fasta_ex.py", line 23, in ?
    scanner.feed(file, consumer)
  File "E:?softwares?Python21?Bio?Fasta?__init__.py", line 225, in feed
    self._scan_record(uhandle, consumer)
  File "E:?softwares?Python21?Bio?Fasta?__init__.py", line 229, in _scan_record
    self._scan_title(uhandle, consumer)
  File "E:?softwares?Python21?Bio?Fasta?__init__.py", line 234, in _scan_title
    read_and_call(uhandle, consumer.title, start='>')
  File "E:?softwares?Python21?Bio?ParserSupport.py", line 326, in read_and_call
    raise SyntaxError, errmsg
SyntaxError: Line does not start with '>':
TTCCCCTGCCTCTCTGGAGAAATGGCTCAGCTCTCATTTAATGCAGCGCTGAAGATGAACGCATTGGGGA