[Biopython-dev] [Biopython - Bug #3308] (New) SeqIO FastaIO: Blank Descriptor causes Indes Out of Range

[redmine at redmine.open-bio.org]

Issue #3308 has been reported by Darren Cullerne.

----------------------------------------
Bug #3308: SeqIO FastaIO: Blank Descriptor causes Indes Out of Range
https://redmine.open-bio.org/issues/3308

Author: Darren Cullerne
Status: New
Priority: Normal
Assignee: 
Category: 
Target version: 
URL: 


Entering a FASTA sequence with a blank descriptor:

">"
"ACTAGTACTAGATCAGACTACAGTACAGAGAGGACATCTATACTACGAGAGACATACTACTCAGCATACGATAC"

Causes the following error:
  File "C:\Python27\lib\site-packages\Bio\SeqIO\__init__.py", line 532, in parse
    for r in i:
  File "C:\Python27\lib\site-packages\Bio\SeqIO\FastaIO.py", line 49, in FastaIterator
    id   = descr.split()[0]
IndexError: list index out of range

Please let me know if there is any further information you require.

Thanks,


----------------------------------------
You have received this notification because this email was added to the New Issue Alert plugin


-- 
You have received this notification because you have either subscribed to it, or are involved in it.
To change your notification preferences, please click here and login: http://redmine.open-bio.org