[Biopython-dev] [Fwd: Question to code]

[Iddo Friedberg]

OK, this is a real bug. NCBIWWW seems to be broken.

I'm having a looksee, but I'd like someone more versed in this than me 
to do so.

Thanks,

Iddo



-------- Original Message --------
Subject: 	Question to code
Date: 	Wed, 16 Feb 2005 15:19:57 +0100
From: 	Eirik Sønneland <eirik.sonneland at student.umb.no>
To: 	idoerg



Dear Freidberg,

I've been having problems parsing my output from NCBI using the example 
code given in Biopython Cookbook. Therefore I tried to follow your code 
described in "Genome Informatics 14(2003). Still I get an error message 
connected to the parsing. Could you please give a hint on what is wrong? 
Is this a bug?? Code and output as follows:

Code:

from Bio.Blast import NCBIWWW
from Bio import Fasta

file_for_blast = open('Fastaformat.txt', 'r')
f_iterator = Fasta.Iterator(file_for_blast)
f_record = f_iterator.next()

b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()

b_record = NCBIWWW.BlastParser().parse_str(b_results)

Output(Have cut out the beginning, only pasted the last part of output):


 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29     ctgcagctcgggctcctgcc 48
              ||||||||||||||||||||
Sbjct: 150928 ctgcagctcgggctcctgcc 150909
</PRE>


<form>

<PRE>
Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 2894376
Number of Hits to DB: 6,089,259
Number of extensions: 328661
Number of successful extensions: 6259
Number of sequences better than 10.0: 2
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's gapped: 6259
Number of HSP's successfully gapped: 2
Number of extra gapped extensions for HSPs above 10.0: 6255
Length of query: 600
Length of database: 13,294,103,689
Length adjustment: 22
Effective length of query: 578
Effective length of database: 13,230,427,417
Effective search space: 7647187047026
Effective search space used: 7647187047026
A: 0
X1: 11 (21.8 bits)
X2: 15 (30.0 bits)
X3: 25 (50.0 bits)
S1: 14 (25.0 bits)
S2: 20 (40.1 bits)


</form>

Traceback (most recent call last):
  File "C:\Python24\MyWorkspace.py", line 50, in -toplevel-
    b_record = NCBIWWW.BlastParser().parse_str(b_results)
  File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 52, in 
parse_str
    return self.parse(File.StringHandle(string))
  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 47, in 
parse
    self._scanner.feed(handle, self._consumer)
  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 99, in 
feed
    self._scan_rounds(uhandle, consumer)
  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 242, 
in _scan_rounds
    self._scan_alignments(uhandle, consumer)
  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 322, 
in _scan_alignments
    raise SyntaxError, "Cannot resolve location at line:\n%s" % line1
SyntaxError: Cannot resolve location at line:
</form>

 >>>

Thanks!

Regards,
Eirik


-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP