[Bioperl-l] BLAST example doesn't work

[Frank Schwach]

it seems that the command line is incorrectly constructed as "blastall 
run ..." and I guess that's because the StandAloneBlast module didn't 
see your "program" parameter.

try:

my $factory = Bio::Tools::Run::StandAloneBlast->new(

   -program =>  'blastn',

   -database =>  'nr',

   -e =>  '1e-5'

);


(parameter keys should start with "-")


Hope that helps

Frank




On 21/02/12 09:16, Enzyme wrote:
> use Bio::Tools::Run::StandAloneBlast;
> my $factory = Bio::Tools::Run::StandAloneBlast->new(p =>  'blastn',
>                                                      d =>  'nr',
>                                                      e =>  '1e-5');
> my $seq = Bio::PrimarySeq->new(-id =>  'test1',
>                                 -seq =>  'AGATCAGTAGATGATAGGGGTAGA');
> my $report = $factory->blastall($seq); # get back a {{PM|Bio::SearchIO}}
> report


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE.