[Bioperl-l] fastq splitter
Michael Muratet
mmuratet at hudsonalpha.org
Tue Feb 28 21:26:25 UTC 2012
On Feb 28, 2012, at 3:11 PM, Sean O'Keeffe wrote:
> Hi,
> I'm trying to write a quick script to separate one large PE fastq
> file into
> 2 separate files, one for each mate pair
>
> The file is of the format (mate1)
> @HWI-ST156:445:C0EDLACXX:4:1101:1496:1039 1:N:0:ATCACG
> CTGCTGGTAGTGCCCAAAGACCTCGAATACAATGGGCTTGGTTTTGATGT
> +
> BCCFFFFEHHHHHJJJJJHIIJIJJIIGIJJJJJJJIJJJI?FHJJIIJA
>
> && (mate2)
>
> @HWI-ST156:445:C0EDLACXX:4:2308:20877:199811 2:Y:0:ATCACG
> TCATAAAAATAACAAAACCACCACCCCATACAAACTCTACTCATCTCCAC
> +
> ##################################################
>
>
> My idea is to separate using a regex such that / 1:/ would be the
> first
> mate pair and / 2:/ would go in the second mate file.
> I implemented the code below but each output file is empty. Can
> someone
> spot my error?
>
> Thanks,
> Sean.
>
> my $infile = shift;
> my $outfile1 = $infile."_1";
> my $outfile2 = $infile."_2";
>
> my $seqin = Bio::SeqIO->new(
> -file => "<$infile",
> -format => "fastq",
> );
> my $seqout1 = Bio::SeqIO->new(
> -file => ">$outfile1",
> -format => "fastq",
> );
>
> my $seqout2 = Bio::SeqIO->new(
> -file => ">$outfile2",
> -format => "fastq",
> );
> while (my $inseq = $seqin->next_seq) {
> if ($seqin->desc =~ / 1:/){
Hi Sean
You're using the desc operator on the stream, not the seq object.
Cheers
Mike
> $seqout1->write_seq($inseq);
> } else {
> $seqout2->write_seq($inseq);
> }
> }
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
Michael Muratet, Ph.D.
Senior Scientist
HudsonAlpha Institute for Biotechnology
mmuratet at hudsonalpha.org
(256) 327-0473 (p)
(256) 327-0966 (f)
Room 4005
601 Genome Way
Huntsville, Alabama 35806
More information about the Bioperl-l
mailing list