[Bioperl-l] Genbank code from Blast results
    Marcelo Iwata 
    marcelo011982 at gmail.com
       
    Tue Aug 18 18:34:17 UTC 2009
    
    
  
hi all..
I was doing a script that take some information of the results of blastn
files.
Everythig was ok, but i have some dificult to pic the Genbank code number
(the 'gb' below).
I tried
$obj->each_accession_number
$hit->name
And some variation of this.
------------------------------
>gnl|UG|Gma#S23062791 gmrtDrNS01_07-B_M13R_E11_087.s1 Water stressed 5h
segment 1 gmrtDrNS01
              Glycine max cDNA 3', mRNA sequence /clone_end=3'
              /gb=CX702616 /gi=58015874 /ug=Gma.18455 /len=853
          Length = 853
 Score = 1336 bits (674), Expect = 0.0
 Identities = 793/832 (95%), Gaps = 8/832 (0%)
 Strand = Plus / Minus
Query: 294858 aaattaacaatgagactccagagtatgtgaggtcctttgaatttgatagcaaattgatgt
294917
              |||||||||||| |||||| |||||||||||||||||  ||||||||||||||||||||
Sbjct: 853    aaattaacaatgtgactcccgagtatgtgaggtccttgaaatttgatagcaaattgatgc
794
----------------------------------------
But, i still don't get it.
thank you
with regards
Miwata
    
    
More information about the Bioperl-l
mailing list