[Bioperl-l] quick pairwise alignment

[Scott Markel]

Alper,

I don't think the Bio::SearchIO data objects provide functions
allowing the retrieval of the query sequence.  You should have
either the sequence object or a file containing it that you used
in the BioPerl BLAST call.

If by "original" sequence you mean the datbase hit, then you'll
have to use NCBI's fastacmd (part of the BLAST suite of programs)
to retrieve the full-length sequence.  Only the portion(s) needed
for the pairwise alignment(s) are contained in the BLAST output.

Of course, using the sequence identifiers you could retrieve the
full-length database ht a number of other ways.

Scott

Scott Markel, Ph.D.
Principal Bioinformatics Architect  email:  smarkel at accelrys.com
Accelrys (SciTegic R&D)             mobile: +1 858 205 3653
10188 Telesis Court, Suite 100      voice:  +1 858 799 5603
San Diego, CA 92121                 fax:    +1 858 799 5222
USA                                 web:    http://www.accelrys.com

http://www.linkedin.com/in/smarkel
Board of Directors: International Society for Computational Biology
Co-chair: ISCB Publications Committee
Associate Editor: PLoS Computational Biology
Editorial Board: Briefings in Bioinformatics


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Dave Messina
> Sent: Wednesday, 26 November 2008 3:54 PM
> To: Alper Yilmaz
> Cc: BioPerl List
> Subject: Re: [Bioperl-l] quick pairwise alignment
> 
> Hi Alper,
> Great -- glad I was able to help.
> 
> is it possible to see the "original" sequence that is used for BLAST in
> the
> > alignment?
> 
> 
> Sorry, I can't remember what ClustalW's output looks like. Would you like
> to
> see something like this?
> 
> AGCGTGAGTAGTAGATGAGTAGTAGTGAGATGTGAGTAGTAAAAAGTGATGATGATGAGTAAAAAAAAA
> |||||||||
> AGCGTGAGT
> 
> If I were to do it, I think, since you get the start and stop positions of
> the hit,  I might try to place the hit string in relation to the query
> string. So in the code from before, instead of printing
> $hsp_obj->query_string, you could print $input1->seq.
> 
> Or, I think if you run blastall outside of BioPerl, there are options for
> query-anchored output, but you'd have to parse that out of the blast
> report
> yourself.
> 
> But those are just off the top of my head. Anyone else reading, please
> chime
> in if you've got better ideas.
> 
> Dave
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l