[Bioperl-l] primer parameters using primer3

[chen li]

I think Dr. Chaudhuri is correct. 

I add the follwoing line codes to my script(actually
copy from the document)

$primer3->add_targets(
PRIMER_PRODUCT_SIZE_RANGE=>'490-510');

$primer3->add_targets('PRIMER_MIN_TM'=>60,
'PRIMER_MAX_TM'=>64);

to design the primers with product size from 490-510
bp and primer annealing Tm from 60 to 64C .

Here is part of the output in the file called
temp.out:

.......... original sequence.....
GTGGGCTGGTGTTGCTTGGAAAATTTCAAAATCCCAAAGTTTCAGGCTTCCCAAAGTTGGCTTGGAAAAATGTGATAGTCTCACCTGAGTCTAGACATGT
.................

PRIMER_PRODUCT_SIZE_RANGE=490-510
PRIMER_MIN_TM=60
PRIMER_MAX_TM=64
PRIMER_PAIR_PENALTY=0.1544
PRIMER_LEFT_PENALTY=0.081468
PRIMER_RIGHT_PENALTY=0.072951
PRIMER_LEFT_SEQUENCE=CCAAAGTTGGCTTGGAAAAA
...............................
PRIMER_PRODUCT_SIZE=501

..............

This is what I want. If you don't set the special
parameters such annealing Tm program will use the
defualt ones. If you set your own parameters they will
show up after the sequence (see this output example).

If one needs to set more parameters and wants to know
what parameters are available just browse the code for
BEGIN section.

Now I have another question: the program always prints
out the original sequence at the beginning is it
possible not to do that?

Thanks all for join this topic,

Li 




--- Roy Chaudhuri <roy at colibase.bham.ac.uk> wrote:

> Hi Li,
> 
> I think the syntax you need is:
> 
>
$primer3->add_targets(PRIMER_PRODUCT_SIZE_RANGE=>'490-510');
> 
> I guess you may also need to change the parameter
> PRIMER_PRODUCT_OPT_SIZE.
> 
> Incidentally, such a restricted product size range
> may mean that Primer3 
> is unable to design any suitable primers. If I
> recall correctly, this 
> doesn't cause an error, you just get a
> Bio::Tools::Primer3 object with 
> no primers in it. I have had some success with
> testing for this, and if 
> necessary relaxing some constraints on primer design
> and re-running 
> Primer3.
> 
> Hope this helps.
> Roy.
> 
> --
> Dr. Roy Chaudhuri
> Bioinformatics Research Fellow
> Division of Immunity and Infection
> University of Birmingham, U.K.
> 
> http://xbase.bham.ac.uk
> 
> > Hi Jason,
> > 
> > I add the line code   
> > $primer3->primer_product_size_range("490-510");
> >  to my script. But it doesn't work nor primer3
> > complains it.
> > 
> > Li
> > 
> > --- Jason Stajich <jason.stajich at duke.edu> wrote:
> > 
> >> > I put up some info on the wiki (and I encourage
> >> > other people to do  
> >> > the same!)
> >> >
> >
>
http://bioperl.org/wiki/Module:Bio::Tools::Run::Primer3
> >> > 
> >> > Set the command line parameters by just calling
> a
> >> > function of the  
> >> > name of the parameter.  To get a list of the
> >> > available options, this  
> >> > perl code will report it to you:
> >> > 
> >> > # what are the arguments, and what do they
> mean?
> >> >    my $args = $primer3->arguments;
> >> > 
> >> >    print "ARGUMENT\tMEANING\n";
> >> >    foreach my $key (keys %{$args}) {print
> "$key\t",
> >> > $$args{$key}, "\n"}
> >> > 
> >> > The info for PRODUCT_SIZE_RANGE is:
> >> >    (size range list, default 100-300) space
> >> > separated list of product  
> >> > sizes eg <a>-<b> <x>-<y>
> >> > 
> >> > I believe you can set the PCR product size with
> >> >   
> $primer3->primer_product_size_range("490-510");
> >> > 
> >> > -jason
> >> > On May 7, 2006, at 3:34 AM, chen li wrote:
> >> > 
> >>> > > Hi all,
> >>> > >
> >>> > > I use Bio::Tools::Run::Primer3 to design PCR
> >> > primers.
> >>> > > I want to change some default values, for
> example,
> >> > to
> >>> > > increase the PCR product size to 490-510 bp
> >> > instead of
> >>> > > using the default value of 100-300 bp. What
> should
> >> > I
> >>> > > do ?
> >>> > >
> >>> > >
> >>> > > Thanks,
> >>> > >
> >>> > > Li
> >>> > >
> >>> > >
> __________________________________________________
> >>> > > Do You Yahoo!?
> >>> > > Tired of spam?  Yahoo! Mail has the best
> spam
> >> > protection around
> >>> > > http://mail.yahoo.com
> >>> > >
> _______________________________________________
> >>> > > Bioperl-l mailing list
> >>> > > Bioperl-l at lists.open-bio.org
> >>> > >
> >> >
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >> > 
> >> > --
> >> > Jason Stajich
> >> > Duke University
> >> > http://www.duke.edu/~jes12
> >> > 
> >> > 
> >> > 
> > 
> > 
> > __________________________________________________
> > Do You Yahoo!?
> > Tired of spam?  Yahoo! Mail has the best spam
> protection around 
> > http://mail.yahoo.com 
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> >
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com