[Bioperl-l] Write a fasta file with custom title line.
Chris Fields
cjfields at uiuc.edu
Thu Aug 31 17:56:18 UTC 2006
Nick,
I think you can do it by changing the preferred ID type to 'display ID' for
the SeqIO object, then changing the display ID to whatever you want:
use Bio::SeqIO;
my $seqin = Bio::SeqIO->new(-file => shift,
-format => 'genbank',);
my $seqout = Bio::SeqIO->new(-fh => \*STDOUT,
-format => 'fasta');
$seqout->preferred_id_type('display');
my $ct = 1;
while (my $seq = $seqin->next_seq) {
$seq->display_id('foo'.$ct);
$seqout->write_seq($seq);
$ct++;
}
This version appends the sequence description:
>foo1 5'UTR in Aspergillus niger icdA mRNA for NADP-dependent isocitrate
dehydrogenase precursor, complete cds.
TCCGTTCTTCCCTCATTCCTCCCCAGGTTCTTGCTTATTGCAGGAAAGATTATTTCCCAG
AGTGAACAGAAACGATTTTCCGGGTTCTCCGATCTGCCCCGTGAAGGTCCCTTACAGCAA
CAGCATCTCGTCCAGTCCGGCTTAACGGCAGCTTCCGAACTCCACCACCGCCTCCTTCCA
GCCGAGAGCTTCACGGCTTCTTGCTTGTCTTTCCCTCGGACTTTCCCCGGTTCCTCCCAC
ACAGCAGGCCCAGTTACTGTCGAGTCTTTGGCAATCCATCCCACACC
>foo2 5'UTR in Fission yeast mRNA for cytochrome c oxidase subunit IV,
complete cds.
GTTATAAATCATCAATAATTGTCTTTTAAG
...
I personally think it would be better to add a 'custom' option so you could
add whatever you wanted without the description added in. What did you have
in mind here?
Chris
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Staffa, Nick (NIH/NIEHS) [C]
> Sent: Thursday, August 31, 2006 11:57 AM
> To: bioperl-l
> Subject: [Bioperl-l] Write a fasta file with custom title line.
>
> I would like to construct title lines for the fasta sequences I want to
> right to a file.
> I don't see in the documentation on-line for SeqIO or write_seq how to
> specify this.
> Please point the way.
>
>
> Nick Staffa
> Telephone: 919-316-4569 (NIEHS: 6-4569)
> Scientific Computing Support Group
> NIEHS Information Technology Support Services Contract
> (Science Task Monitor: Jack L. Field( field1 at niehs.nih.gov )
> National Institute of Environmental Health Sciences
> National Institutes of Health
> Research Triangle Park, North Carolina
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
More information about the Bioperl-l
mailing list