[Bioperl-l] Yet another 'what version's supposed to work?' question?

[Jason Stajich]

Exonerate works fine, I don't think this is the problem  The tests  
pass for me on exonerate 1.0.0 and with the latest code in CVS -- I  
spent more than a few hours on this on Monday so you need to make  
sure you've got .

$ exonerate --version
exonerate from exonerate version 1.0.0
Using glib version 1.2.10
Built on May  4 2005
Branch: unnamed branch

[jes12 at head2 run]$ make test_Exonerate
PERL_DL_NONLAZY=1 /usr/bin/perl -Iblib/arch -Iblib/lib -I/usr/lib/ 
perl5/5.8.0/i386-linux-thread-multi -I/usr/lib/perl5/5.8.0 -e 'use  
Test::Harness qw(&runtests $verbose); $verbose=0; runtests @ARGV;' t/ 
Exonerate.t
t/Exonerate....ok
All tests successful.

Please be sure you have the latest code from CVS for both bioperl- 
live and bioperl-run, I checked in changes to Bio/SearchIO/ 
exonerate.pm so that it properly parses VULGAR and CIGAR.  So  
bioperl-1.5.1-RC1 is

You may want to subscribe to bioperl-guts-l to see the changes as  
they come in if you are going to be working on the bleeding edge/ 
fixing bugs that other folks are working on too.

If you are wanting verify things, run exonerate with --showtargetgff  
yes --showquerygff yes
and you'll see GFF (although note that reverse strand features will  
be in reverse coordinates, see posts to the mailiing list about this)


-jason
On Sep 28, 2005, at 6:24 PM, George Hartzell wrote:

>
> I'm digging into bioperl-run on FreeBSD.
>
> I've built a port for exonerate-1.0.0, and it passes all of it's tests
> (but not with --enable-assertions, I've asked Guy about that...).
>
> t/Exonerate.t blows up all over the place, but I think that the
> problem is that the cDNA<->genomic alignments that are coming back
> aren't quite what the test expect to see.  They seem reasonable
> though, leading and/or trailing hsp's seem to have been broken into
> smaller parts.
>
> Sim4 gives answers that generally agree with both the test expected
> and the calculated data.
>
> Actually, looking at the exonerate text output and what I'm seeing in
> the perl debugger, it looks like some part of the current bioperl
> parser is treating this:
>
>     4 : GTTGTGCT- 
> GGGGGGGTCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCGCTCCGTCGGCCC :   64
>         |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
>    29 :  
> GTTGTGCTGGGGGGGGTCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCGCTCCGTCGGCCC :   90
>
> As two hsps, one from 4->11/29->36, then 12->/38->....  The exonerate
> expected data expects it as a single HSP.
>
> Does anyone out there have any experience with the exonerate and how
> well it works?
>
> g.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12