[Bioperl-l] Multiple tags of same name in a Bio::SeqFeature::Generic object

[Govind Chandra]

Hi,

I wish to assign multiple tags of the same name in a
Bio::SeqFeature::Generic object. What I am doing below does not work. I
did not expect it to. What I get is:

FT                   /db_xref="InterPro:IPR001957"

If I pass a reference to an array to a single db_xref tag, that does not
work either. I get:

FT                   /db_xref="ARRAY(0x841da94)"

If I pick up a feature from an embl file (rather than build my own)
which has multiple db_xref tags and add it to my sequence using
add_SeqFeature I do get multiple db_xref tags in the output. So I
conclude that I am not building the Bio::SeqFeature::Generic object
right.

Could someone help me with this please. I am using BioPerl 1.4.0.

Thanks

Govind

Govind Chandra
Microbiology
John Innes Centre
Norwich UK.



### begin script ###
use Bio::SeqIO;
use Bio::Seq;
use Bio::SeqFeature::Generic;

$seq="agaagcgcaccgcacccgcgagcgccttcgccgcgggccctttcg";

$seqout=Bio::SeqIO->new('-fh' => \*STDOUT, '-format' => 'embl');

$seqobj=Bio::Seq->new('-seq' => $seq);

#@xrefs=("GOA:Q8FUL7","HSSP:1J1V","InterPro:IPR001957");

$feature=Bio::SeqFeature::Generic->new(-start => 10,
				       -end => 20,
				       -strand => 1,
				       -primary => 'RBS',
				       -tag => {
#						db_xref=> \@xrefs
						db_xref => "GOA:Q8FUL7",
						db_xref => "HSSP:1J1V",
						db_xref => "InterPro:IPR001957"
					       }
				      );
$seqobj->add_SeqFeature($feature);
$seqout->write_seq($seqobj);

### end script ###