[Bioperl-l] build Align object from scratch?

[Fernan Aguero]

Hi!

is it possible to build an alignment object without reading an
alignment from a file, a filehandle etc?

I'm reading the pods for AlignIO, AlignI, SimpleAlign, etc
and I don't see this as a possibility.

What I'm doing is reading gapped sequences from tables in
a MySQL database (i.e. already aligned sequences). I need to
recreate the alignment in my program to then take some
portions of these sequences based on their overlappings.

Examples of the kind of sequences that I'll be reading are:

ATGGTATGGAGTGATGAGTGTGTGA
----TATGGAGTGATGAGT------
ATGGTATGGAGTG------------
--------------TGAGTGTGTGA

Essentially this looks like an aligned FASTA ... of course I
could write an alignment in this format to a tmp file and
then read it again using AlignIO ... but given that I
already have this info available to my program, I just
thought this was not the most elegant way to do it.

Is there another?

thanks in advance for any tip,

Fernan

-- 
Fernan Aguero -  fernan at iib.unsam.edu.ar
Phone: +54 11 4580-7255/7 ext 310, Fax: +54 11 4752-9639
Check http://genoma.unsam.edu.ar/~fernan for more info.