[Bioperl-l] make test!!
Nathan Spencer Haigh
nathanhaigh at ukonline.co.uk
Thu Oct 28 06:03:31 EDT 2004
Ignore this old message, all these have now been fixed!
Nathan
Quoting Nathan Haigh <nathanhaigh at ukonline.co.uk>:
> Ok, I've done some more testing (with the latest CVS 9am GMT) and here is
> what I've found! I've run "namke test" with and without
> BIOPERLDEBUG, and running individual tests using " perl -I. -w
> t/test_name.t".
>
> Below are the contents of 3 files with details of errors, if you would like
> me to e-mail the files directly directly to you, let me
> know:
> Errors.txt - summary and details of failed tests, and other tests with
> peculiar warnings etc
> Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set
> Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I.
> -w t/test_name.t"
>
> My System:
> WinXP Pro
> ActiveState Perl 5.8.0
> Nmake 6.00.8168.0
>
> My Summary:
> ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in
> other tests!
> Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but
> doesn't appear in summary!
> Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124
> ProtPsm.t - needs "plan tests" in test file changing to 5. When running the
> individual test can't locate
> Bio::Matrix::PSM::ProtMatrix
> Registry.t - several error including "No seqdatabase.ini file found", " No
> database with name testflat in Registry"
> Primaryqual.t - Test returned status 255. and 'Can't locate object method
> "header"' in individual test
> seqread_fail.t - gives an exception, is this supposed to happen?
>
> Hope this help to iron out bugs when running BioPerl on Windows!
> Nathan
>
>
> Errors_debug.txt
> ##############
> Failed Test Stat Wstat Total Fail Failed List of Failed
> -------------------------------------------------------------------------------
> t\ESEfinder.t 5 1280 12 10 83.33% 3-12
> t\Index.t 22 5632 41 21 51.22% 21-41
> t\ProtPsm.t 1 ?? % ??
> t\Registry.t 255 65280 11 8 72.73% 4-11
> t\primaryqual.t 255 65280 31 0 0.00% ??
> t\seqread_fail.t 255 65280 13 0 0.00% ??
> 2 subtests skipped.
> Failed 6/193 test scripts, 96.89% okay. 35/8919 subtests failed, 99.61%
> okay.
> NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' :
> return code '0xff'
> Stop.
>
> Particulars:
> ------------
> t\Biblio_biofetch............ok 1/11Warning: Couldn't connect to BioFetch
> server with Bio::DB::Medline.pm!
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: retrieval type pipeline unsupported
>
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl
> ib\lib/Bio/Root/Root.pm:328
> STACK: Bio::DB::Biblio::biofetch::get_seq_stream
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbi
> operl-live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:237
> STACK: Bio::DB::DBFetch::get_Stream_by_id
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l
> ive-debug\blib\lib/Bio/DB/DBFetch.pm:194
> STACK: Bio::DB::Biblio::biofetch::get_by_id
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl
> -live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:153
> STACK: t\Biblio_biofetch.t:71
> -----------------------------------------------------------
>
> t\ESEfinder..................dubious
> Test returned status 5 (wstat 1280, 0x500)
> DIED. FAILED tests 3-12
> Failed 10/12 tests, 16.67% okay
>
> t\Index......................NOK 21Can't call method "length" on an undefined
> value at t\Index.t line 126, <GEN6> line
> 54.
> t\Index......................dubious
> Test returned status 22 (wstat 5632, 0x1600)
> DIED. FAILED tests 21-41
> Failed 21/41 tests, 48.78% okay
>
> t\primaryqual................dubious
> Test returned status 255 (wstat 65280, 0xff00)
> after all the subtests completed successfully
>
> t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok,
> expected 1
>
> t\Registry...................ok 2/11This Perl doesn't implement function
> getpwuid(). Skipping...
>
> -------------------- WARNING ---------------------
> MSG: No seqdatabase.ini file found in ~/.bioinformatics/
> nor in /etc/bioinformatics/ nor in directory specified by
> t/data/registry/flat;t/data/registry/bdb. Using web to get database registry
> from
> http://www.open-bio.org/registry/seqdatabase.ini
> ---------------------------------------------------
>
> -------------------- WARNING ---------------------
> MSG: Stored the default registry configuration in
> /.bioinformatics/seqdatabase.ini
> ---------------------------------------------------
> t\Registry...................NOK 5
> -------------------- WARNING ---------------------
> MSG: No database with name testflat in Registry
> ---------------------------------------------------
> Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line
> 66, <FH> line 11.
> t\Registry...................dubious
> Test returned status 255 (wstat 65280, 0xff00)
> DIED. FAILED tests 4-11
> Failed 8/11 tests, 27.27% okay
>
> t\SeqIO......................ok 196/284
> -------------------- WARNING ---------------------
> MSG: Bio::PrimarySeq=HASH(0x2a9363c) is not a SeqI compliant sequence
> object!
> STACK Bio::SeqIO::embl::write_seq
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
> g\blib\lib/Bio\SeqIO\embl.pm:410
> STACK toplevel t\SeqIO.t:527
> t\SeqIO......................ok 198/284
> t\SeqIO......................ok 199/284-------------------- WARNING
> ---------------------
> MSG: test is not a SeqI compliant sequence object!
> STACK Bio::SeqIO::embl::write_seq
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
> g\blib\lib/Bio\SeqIO\embl.pm:410
> STACK (eval) t\SeqIO.t:530
> STACK toplevel t\SeqIO.t:529
> t\SeqIO......................ok 253/284Location parse, processing 1..105
> Location parse, processing <1..>105
> Location parse, processing 69^70
> Location parse, processing 103^102
> t\SeqIO......................ok 259/284
> -------------------- WARNING ---------------------
> MSG: When building a location, start (103) is expected to be less than end
> (102), however it was not. Switching start
> and end and setting strand to -1
> STACK Bio::Location::Atomic::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
> \blib\lib/Bio/Location/Atomic.pm:104
> STACK Bio::Location::Simple::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
> \blib\lib/Bio\Location\Simple.pm:91
> STACK Bio::Factory::FTLocationFactory::_parse_location
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
> pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
> t\SeqIO......................ok 262/284STACK
> Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Softwa
>
re\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
> STACK (eval)
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
> FTHelper.pm:124
> STACK Bio::SeqIO::FTHelper::_generic_seqfeature
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
> perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
> STACK Bio::SeqIO::genbank::next_seq
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-de
> bug\blib\lib/Bio\SeqIO\genbank.pm:488
> STACK (eval) t\SeqIO.t:681
> STACK toplevel t\SeqIO.t:680
>
> t\seqread_fail...............ok 1/13
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: BioFetch Error 4: ID [XXX111] not found in database
> [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:
> XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession].
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl
> ib\lib/Bio/Root/Root.pm:328
> STACK: Bio::DB::BioFetch::postprocess_data
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-
> live-debug\blib\lib/Bio/DB/BioFetch.pm:406
> STACK: Bio::DB::WebDBSeqI::get_seq_stream
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l
> ive-debug\blib\lib/Bio/DB/WebDBSeqI.pm:525
> STACK: Bio::DB::WebDBSeqI::get_Stream_by_id
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl
> -live-debug\blib\lib/Bio/DB/WebDBSeqI.pm:287
> STACK: Bio::DB::WebDBSeqI::get_Seq_by_id
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li
> ve-debug\blib\lib/Bio/DB/WebDBSeqI.pm:153
> STACK: main::fetch t\seqread_fail.t:69
> STACK: t\seqread_fail.t:81
> -----------------------------------------------------------
> t\seqread_fail...............dubious
> Test returned status 255 (wstat 65280, 0xff00)
> after all the subtests completed successfully
>
> t\Swiss......................ok 2/5Location parse, processing 1..?
>
> -------------------- WARNING ---------------------
> MSG: could not find a valid fuzzy encoding for ?
> STACK Bio::Location::Fuzzy::_fuzzypointdecode
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope
> rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554
> STACK Bio::Location::Fuzzy::end
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
> blib\lib/Bio\Location\Fuzzy.pm:254
> STACK Bio::Location::Atomic::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
> \blib\lib/Bio/Location/Atomic.pm:101
> STACK Bio::Location::Fuzzy::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
> blib\lib/Bio/Location/Fuzzy.pm:139
> STACK Bio::Factory::FTLocationFactory::_parse_location
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
> pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
> STACK Bio::Factory::FTLocationFactory::from_string
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof
> bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
> STACK (eval)
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
> FTHelper.pm:124
> STACK Bio::SeqIO::FTHelper::_generic_seqfeature
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
> perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
> STACK Bio::SeqIO::swiss::next_seq
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
> g\blib\lib/Bio\SeqIO\swiss.pm:326
> STACK toplevel t\Swiss.t:47
> Location parse, processing ?..409
>
> -------------------- WARNING ---------------------
> MSG: could not find a valid fuzzy encoding for ?
> STACK Bio::Location::Fuzzy::_fuzzypointdecode
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope
> rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554
> STACK Bio::Location::Fuzzy::start
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
> g\blib\lib/Bio\Location\Fuzzy.pm:229
> STACK Bio::Location::Atomic::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
> \blib\lib/Bio/Location/Atomic.pm:100
> STACK Bio::Location::Fuzzy::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
> blib\lib/Bio\Location\Fuzzy.pm:139
> STACK Bio::Factory::FTLocationFactory::_parse_location
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
> pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
> STACK Bio::Factory::FTLocationFactory::from_string
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof
> bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
> STACK (eval)
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
> FTHelper.pm:124
> STACK Bio::SeqIO::FTHelper::_generic_seqfeature
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
> perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
> STACK Bio::SeqIO::swiss::next_seq
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
> g\blib\lib/Bio\SeqIO\swiss.pm:326
> STACK toplevel t\Swiss.t:47
> Location parse, processing 388..388
> Location parse, processing 1..?
>
> -------------------- WARNING ---------------------
> MSG: could not find a valid fuzzy encoding for ?
> STACK Bio::Location::Fuzzy::_fuzzypointdecode
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope
> rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554
> STACK Bio::Location::Fuzzy::end
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
> blib\lib/Bio\Location\Fuzzy.pm:254
> STACK Bio::Location::Atomic::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
> \blib\lib/Bio/Location/Atomic.pm:101
> STACK Bio::Location::Fuzzy::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
> blib\lib/Bio\Location\Fuzzy.pm:139
> STACK Bio::Factory::FTLocationFactory::_parse_location
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
> pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
> STACK Bio::Factory::FTLocationFactory::from_string
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof
> bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
> STACK (eval)
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
> FTHelper.pm:124
> STACK Bio::SeqIO::FTHelper::_generic_seqfeature
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
> perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
> STACK Bio::SeqIO::swiss::next_seq
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
> g\blib\lib/Bio\SeqIO\swiss.pm:326
> STACK toplevel t\Swiss.t:62
> Location parse, processing ?..409
>
> -------------------- WARNING ---------------------
> MSG: could not find a valid fuzzy encoding for ?
> STACK Bio::Location::Fuzzy::_fuzzypointdecode
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope
> rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554
> STACK Bio::Location::Fuzzy::start
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
> g\blib\lib/Bio\Location\Fuzzy.pm:229
> STACK Bio::Location::Atomic::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
> \blib\lib/Bio/Location/Atomic.pm:100
> STACK Bio::Location::Fuzzy::new
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
> blib\lib/Bio\Location\Fuzzy.pm:139
> STACK Bio::Factory::FTLocationFactory::_parse_location
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
> pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
> STACK Bio::Factory::FTLocationFactory::from_string
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof
> bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
> STACK (eval)
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
> FTHelper.pm:124
> STACK Bio::SeqIO::FTHelper::_generic_seqfeature
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
> perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
> STACK Bio::SeqIO::swiss::next_seq
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
> g\blib\lib/Bio\SeqIO\swiss.pm:326
> STACK toplevel t\Swiss.t:62
> Location parse, processing 388..388
> t\Swiss......................ok
>
>
> errors.txt
> #######
> Failed Test Stat Wstat Total Fail Failed List of Failed
> -------------------------------------------------------------------------------
> t\Index.t 22 5632 41 21 51.22% 21-41
> t\ProtPsm.t 1 ?? % ??
> t\Registry.t 255 65280 11 8 72.73% 4-11
> t\primaryqual.t 255 65280 31 0 0.00% ??
> t\seqread_fail.t 255 65280 13 0 0.00% ??
> 115 subtests skipped.
> Failed 5/193 test scripts, 97.41% okay. 25/8919 subtests failed, 99.72%
> okay.
> NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' :
> return code '0xff'
> Stop.
>
> Particulars:
> ------------
> t\Index......................NOK 21Can't call method "length" on an undefined
> value at t\Index.t line 126, <GEN6> line
> 54.
> t\Index......................dubious
> Test returned status 22 (wstat 5632, 0x1600)
> DIED. FAILED tests 21-41
> Failed 21/41 tests, 48.78% okay
>
> t\primaryqual................dubious
> Test returned status 255 (wstat 65280, 0xff00)
> after all the subtests completed successfully
>
> t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok,
> expected 1
>
> t\Registry...................ok 2/11This Perl doesn't implement function
> getpwuid(). Skipping...
>
> -------------------- WARNING ---------------------
> MSG: No seqdatabase.ini file found in ~/.bioinformatics/
> nor in /etc/bioinformatics/ nor in directory specified by
> t/data/registry/flat;t/data/registry/bdb. Using web to get database registry
> from
> http://www.open-bio.org/registry/seqdatabase.ini
> ---------------------------------------------------
>
> -------------------- WARNING ---------------------
> MSG: Stored the default registry configuration in
> /.bioinformatics/seqdatabase.ini
> ---------------------------------------------------
> t\Registry...................ok 3/11
> t\Registry...................NOK 5-------------------- WARNING
> ---------------------
> MSG: No database with name testflat in Registry
> ---------------------------------------------------
> Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line
> 66, <FH> line 11.
> t\Registry...................dubious
> Test returned status 255 (wstat 65280, 0xff00)
> DIED. FAILED tests 4-11
>
>
> t\seqread_fail...............ok 1/13
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: BioFetch Error 4: ID [XXX111] not found in database
> [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:
> XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession].
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
>
K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live\blib\lib
> /Bio/Root/Root.pm:328
> STACK: Bio::DB::BioFetch::postprocess_data
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-
> live\blib\lib/Bio/DB/BioFetch.pm:406
> STACK: Bio::DB::WebDBSeqI::get_seq_stream
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l
> ive\blib\lib/Bio/DB/WebDBSeqI.pm:525
> STACK: Bio::DB::WebDBSeqI::get_Stream_by_id
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl
> -live\blib\lib/Bio/DB/WebDBSeqI.pm:287
> STACK: Bio::DB::WebDBSeqI::get_Seq_by_id
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li
> ve\blib\lib/Bio/DB/WebDBSeqI.pm:153
> STACK: main::fetch t\seqread_fail.t:69
> STACK: t\seqread_fail.t:81
> -----------------------------------------------------------
> t\seqread_fail...............dubious
> Test returned status 255 (wstat 65280, 0xff00)
> after all the subtests completed successfully
>
>
> perl_tests.txt
> ###########
> perl -I. -w t/ESEfinder.t
> -------------------------
> 1..12
> error is 0
> ok 1
> ok 2
> $Bio::Tools::Analysis::DNA::ESEfinder=HASH(0x1db571c) = bless( {
>
> # verbose stuff here removed
>
> >bioperl
> atcgatgctatgcatgctatgggtgtgattcgatgcgactgttcatcgtagccccccccc
> cccccctttt
> ok 3
> Subroutine new redefined at Bio\Location\Simple.pm line 89, <GEN3> line 31.
> Subroutine start redefined at Bio\Location\Simple.pm line 111, <GEN3> line
> 31.
> Subroutine end redefined at Bio\Location\Simple.pm line 137, <GEN3> line 31.
> Subroutine length redefined at Bio\Location\Simple.pm line 174, <GEN3> line
> 31.
> Subroutine location_type redefined at Bio\Location\Simple.pm line 265, <GEN3>
> line 31.
> Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, <GEN3>
> line 31.
> Subroutine trunc redefined at Bio\Location\Simple.pm line 343, <GEN3> line
> 31.
> ok 4
> ok 5
> ok 6
> ok 7
> ok 8
> ok 9
> ok 10
> ok 11
> ok 12
>
>
> perl -I. -w t/Index.t
> ---------------------
> 1..41
> ok 1
> ok 2
> ok 3
> ok 4
> ok 5
> ok 6
> ok 7
> ok 8
> ok 9
> ok 10
> ok 11
> ok 12
> ok 13
> ok 14
> Subroutine new redefined at Bio\Location\Simple.pm line 89, <GEN4> line 87.
> Subroutine start redefined at Bio\Location\Simple.pm line 111, <GEN4> line
> 87.
> Subroutine end redefined at Bio\Location\Simple.pm line 137, <GEN4> line 87.
> Subroutine length redefined at Bio\Location\Simple.pm line 174, <GEN4> line
> 87.
> Subroutine location_type redefined at Bio\Location\Simple.pm line 265, <GEN4>
> line 87.
> Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, <GEN4>
> line 87.
> Subroutine trunc redefined at Bio\Location\Simple.pm line 343, <GEN4> line
> 87.
> Subroutine new redefined at Bio\Location\Fuzzy.pm line 137, <GEN4> line 92.
> Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 164, <GEN4>
> line 92.
> Subroutine start redefined at Bio\Location\Fuzzy.pm line 226, <GEN4> line
> 92.
> Subroutine end redefined at Bio\Location\Fuzzy.pm line 251, <GEN4> line 92.
> Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 276, <GEN4> line
> 92.
> Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 295, <GEN4> line
> 92.
> Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 315, <GEN4>
> line 92.
> Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 344, <GEN4> line
> 92.
> Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 363, <GEN4> line
> 92.
> Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 383, <GEN4>
> line 92.
> Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 450, <GEN4>
> line 92.
> Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 537,
> <GEN4> line 92.
> ok 15
> ok 16
> ok 17
> ok 18
> ok 19
> ok 20
> not ok 21
> # Failed test 21 in t/Index.t at line 118
> not ok 22
> # Failed test 22 in t/Index.t at line 125
> Can't call method "length" on an undefined value at t/Index.t line 126,
> <GEN6> line 54.
>
>
> perl -I. -w t/ProtPsm.t
> -----------------------
> 1..1
> Can't locate package Bio::Matrix::PSM::ProtMatrix for
> @Bio::Matrix::PSM::ProtPsm::ISA at t/ProtPsm.t line 22.
> ok 1
> ok 2
> ok 3
> ok 4
> ok 5
>
>
> perl -I. -w t/Registry.t
> ------------------------
> 1..11
> ok 1
> ok 2
> This Perl doesn't implement function getpwuid(). Skipping...
>
> -------------------- WARNING ---------------------
> MSG: No seqdatabase.ini file found in ~/.bioinformatics/
> nor in /etc/bioinformatics/ nor in directory specified by
> t/data/registry/flat;t/data/registry/bdb. Using web to get database registry
> from
> http://www.open-bio.org/registry/seqdatabase.ini
> ---------------------------------------------------
>
> -------------------- WARNING ---------------------
> MSG: Stored the default registry configuration in
> /.bioinformatics/seqdatabase.ini
> ---------------------------------------------------
> ok 3
> not ok 4
> # Failed test 4 in t/Registry.t at line 61
> not ok 5
> # Failed test 5 in t/Registry.t at line 63
>
> -------------------- WARNING ---------------------
> MSG: No database with name testflat in Registry
> ---------------------------------------------------
> not ok 6
> # Failed test 6 in t/Registry.t at line 65
> Can't call method "get_Seq_by_id" on an undefined value at t/Registry.t line
> 66, <FH> line 11.
>
>
> perl -I. -w t/primaryqual.t
> ---------------------------
> # lots of output then:
> Can't locate object method "header" via package "Bio::Seq::SeqWithQuality" at
> Bio\SeqIO\qual.pm line 211, <GEN0> line
> 1.
>
>
>
> > -----Original Message-----
> > From: Brian Osborne [mailto:brian_osborne at cognia.com]
> > Sent: 20 October 2004 19:04
> > To: nathanhaigh at ukonline.co.uk; 'Bioperl'
> > Subject: RE: [Bioperl-l] make test!!
> >
> > Nathan,
> >
> > I noticed most of the Registry tests failing. I know what part of the
> > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I
> > think I've fixed at least that part. Can you install the most recent
> > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again?
> >
> > >perl -w -I. t/Registry.t
> >
> >
> > Brian O.
> >
> > -----Original Message-----
> > From: bioperl-l-bounces at portal.open-bio.org
> > [mailto:bioperl-l-bounces at portal.open-bio.org]On Behalf Of Nathan Haigh
> > Sent: Wednesday, October 20, 2004 10:20 AM
> > To: 'Bioperl'
> > Subject: RE: [Bioperl-l] make test!!
> >
> > Apologise for all the pervious messages! I just wanted to get this onto
> the
> > mailing list:
> >
> > I have managed to do a "nmake test" (WinXP) on bioperl-live.
> >
> > System: WinXP Pro
> > ActiveState Perl 5.8.0 build 804
> > Nmake v6.00.8168.0
> >
> > A note beforehand:
> > The error message I had previously got, and heard others have also
> received
> > on other OS's. That contain a "line too long" error when
> > trying "make test", is due to the limitations of the particular OS.
> Versions
> > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21)
> > have got round this problem by splitting long command lines from Makefiles
> > into a series of smaller commands.
> >
> > Test Summary:
> > Failed Test Stat Wstat Total Fail Failed List of Failed
> >
> ----------------------------------------------------------------------------
> > ---
> > t\Index.t 22 5632 41 21 51.22% 21-41
> > t\Registry.t 22 5632 11 9 81.82% 3-11
> > t\seqread_fail.t 255 65280 13 0 0.00% ??
> > 115 subtests skipped.
> > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66%
> > okay.
> > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' :
> > return code '0xff'
> > Stop.
> >
> > Particulars:
> > t\Index......................NOK 21Can't call method "length" on an
> > undefined value at t\Index.t line 124, <GEN6> line
> > 54.
> > t\Index......................dubious
> > Test returned status 22 (wstat 5632, 0x1600)
> > DIED. FAILED tests 21-41
> > Failed 21/41 tests, 48.78% okay
> > t\Registry...................ok 2/11The getpwuid function is unimplemented
> > at K:\Downloads\FlashGet\Software\Bioinform
> > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116.
> > t\Registry...................dubious
> > Test returned status 22 (wstat 5632, 0x1600)
> > t\seqread_fail...............ok 1/13
> > ------------- EXCEPTION: Bio::Root::Exception -------------
> > MSG: BioFetch Error 4: ID [XXX111] not found in database
> > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:
> > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession].
> > STACK: Error::throw
> > STACK: Bio::Root::Root::throw
> >
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li
> > b/Bio/Root/R
> > oot.pm:328
> > STACK: Bio::DB::BioFetch::postprocess_data
> >
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l
> > ib/Bio/DB/BioFetch.pm:406
> > STACK: Bio::DB::WebDBSeqI::get_seq_stream
> >
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li
> > b/Bio/DB/WebDBSeqI.pm:525
> > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id
> > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\
> > lib/Bio/DB/WebDBSeqI.pm:287
> > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id
> >
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li
> > b
> > /Bio/DB/WebDBSeqI.pm:153
> > STACK: main::fetch t\seqread_fail.t:69
> > STACK: t\seqread_fail.t:81
> > -----------------------------------------------------------
> > t\seqread_fail...............dubious
> > Test returned status 255 (wstat 65280, 0xff00)
> > after all the subtests completed successfully
> >
> >
> > Nathan
> >
> > > -----Original Message-----
> > > From: bioperl-l-bounces at portal.open-bio.org
> > [mailto:bioperl-l-bounces at portal.open-bio.org] On Behalf Of Aaron J.
> Mackey
> > > Sent: 14 October 2004 21:27
> > > To: Bioperl
> > > Subject: [Bioperl-l] make test!!
> > > Importance: High
> > >
> > >
> > > I've had only a very few people send me feedback about the current
> > > state of bioperl-live "make test" on your favorite
> > > old/crotchety/obscure platforms. I'm writing the Change log and
> > > thinking about branching, but I'm an experimentalist, I need data!
> > >
> > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure
> > > you have everything, "make distclean" if you've built from the cvs
> > > checkout before, and start from scratch with the usual litany: perl
> > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron.
> > >
> > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care
> > > about, not so much all the verbiage (unless there's specific verbiage
> > > related to the end result ...)
> > >
> > > Thanks,
> > >
> > > -Aaron
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l at portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > > ---
> > > avast! Antivirus: Inbound message clean.
> > > Virus Database (VPS): 0442-2, 14/10/2004
> > > Tested on: 14/10/2004 21:59:20
> > > avast! is copyright (c) 2000-2003 ALWIL Software.
> > > http://www.avast.com
> > >
> > >
> >
> > ---
> > avast! Antivirus: Outbound message clean.
> > Virus Database (VPS): 0442-3, 15/10/2004
> > Tested on: 20/10/2004 15:20:04
> > avast! is copyright (c) 2000-2003 ALWIL Software.
> > http://www.avast.com
> >
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> > ---
> > avast! Antivirus: Inbound message clean.
> > Virus Database (VPS): 0442-3, 15/10/2004
> > Tested on: 21/10/2004 07:12:10
> > avast! is copyright (c) 2000-2003 ALWIL Software.
> > http://www.avast.com
> >
> >
>
> ---
> avast! Antivirus: Outbound message clean.
> Virus Database (VPS): 0443-1, 20/10/2004
> Tested on: 21/10/2004 12:58:59
> avast! is copyright (c) 2000-2003 ALWIL Software.
> http://www.avast.com
>
>
>
>
> ---
> avast! Antivirus: Outbound message clean.
> Virus Database (VPS): 0443-1, 20/10/2004
> Tested on: 21/10/2004 13:46:01
> avast! is copyright (c) 2000-2003 ALWIL Software.
> http://www.avast.com
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
--
----------------------------------------------
This mail sent through http://www.ukonline.net
More information about the Bioperl-l
mailing list