[Bioperl-l] make test!!
Nathan Haigh
nathanhaigh at ukonline.co.uk
Thu Oct 21 07:59:04 EDT 2004
Ok, I've done some more testing (with the latest CVS 9am GMT) and here is what I've found! I've run "namke test" with and without
BIOPERLDEBUG, and running individual tests using " perl -I. -w t/test_name.t".
Attached are 3 files with details of errors:
Errors.txt - summary and details of failed tests, and other tests with peculiar warnings etc
Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set
Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I. -w t/test_name.t"
My System:
WinXP Pro
ActiveState Perl 5.8.0
Nmake 6.00.8168.0
My Summary:
ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in other tests!
Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but doesn't appear in summary!
Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124
ProtPsm.t - needs "plan tests" in test file changing to 5. When running the individual test can't locate
Bio::Matrix::PSM::ProtMatrix
Registry.t - several error including "No seqdatabase.ini file found", " No database with name testflat in Registry"
Primaryqual.t - Test returned status 255. and 'Can't locate object method "header"' in individual test
seqread_fail.t - gives an exception, is this supposed to happen?
Hope this help to iron out bugs when running BioPerl on Windows!
Nathan
> -----Original Message-----
> From: Brian Osborne [mailto:brian_osborne at cognia.com]
> Sent: 20 October 2004 19:04
> To: nathanhaigh at ukonline.co.uk; 'Bioperl'
> Subject: RE: [Bioperl-l] make test!!
>
> Nathan,
>
> I noticed most of the Registry tests failing. I know what part of the
> problem is (getpwuid() not implemented in Windows/Activestate Perl) and I
> think I've fixed at least that part. Can you install the most recent
> Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again?
>
> >perl -w -I. t/Registry.t
>
>
> Brian O.
>
> -----Original Message-----
> From: bioperl-l-bounces at portal.open-bio.org
> [mailto:bioperl-l-bounces at portal.open-bio.org]On Behalf Of Nathan Haigh
> Sent: Wednesday, October 20, 2004 10:20 AM
> To: 'Bioperl'
> Subject: RE: [Bioperl-l] make test!!
>
> Apologise for all the pervious messages! I just wanted to get this onto the
> mailing list:
>
> I have managed to do a "nmake test" (WinXP) on bioperl-live.
>
> System: WinXP Pro
> ActiveState Perl 5.8.0 build 804
> Nmake v6.00.8168.0
>
> A note beforehand:
> The error message I had previously got, and heard others have also received
> on other OS's. That contain a "line too long" error when
> trying "make test", is due to the limitations of the particular OS. Versions
> of ExtUtils::MakeMaker >= 6.06 (current version: 6.21)
> have got round this problem by splitting long command lines from Makefiles
> into a series of smaller commands.
>
> Test Summary:
> Failed Test Stat Wstat Total Fail Failed List of Failed
> ----------------------------------------------------------------------------
> ---
> t\Index.t 22 5632 41 21 51.22% 21-41
> t\Registry.t 22 5632 11 9 81.82% 3-11
> t\seqread_fail.t 255 65280 13 0 0.00% ??
> 115 subtests skipped.
> Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66%
> okay.
> NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' :
> return code '0xff'
> Stop.
>
> Particulars:
> t\Index......................NOK 21Can't call method "length" on an
> undefined value at t\Index.t line 124, <GEN6> line
> 54.
> t\Index......................dubious
> Test returned status 22 (wstat 5632, 0x1600)
> DIED. FAILED tests 21-41
> Failed 21/41 tests, 48.78% okay
> t\Registry...................ok 2/11The getpwuid function is unimplemented
> at K:\Downloads\FlashGet\Software\Bioinform
> atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116.
> t\Registry...................dubious
> Test returned status 22 (wstat 5632, 0x1600)
> t\seqread_fail...............ok 1/13
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: BioFetch Error 4: ID [XXX111] not found in database
> [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:
> XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession].
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li
> b/Bio/Root/R
> oot.pm:328
> STACK: Bio::DB::BioFetch::postprocess_data
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l
> ib/Bio/DB/BioFetch.pm:406
> STACK: Bio::DB::WebDBSeqI::get_seq_stream
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li
> b/Bio/DB/WebDBSeqI.pm:525
> STACK: Bio::DB::WebDBSeqI::get_Stream_by_id
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\
> lib/Bio/DB/WebDBSeqI.pm:287
> STACK: Bio::DB::WebDBSeqI::get_Seq_by_id
> K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li
> b
> /Bio/DB/WebDBSeqI.pm:153
> STACK: main::fetch t\seqread_fail.t:69
> STACK: t\seqread_fail.t:81
> -----------------------------------------------------------
> t\seqread_fail...............dubious
> Test returned status 255 (wstat 65280, 0xff00)
> after all the subtests completed successfully
>
>
> Nathan
>
> > -----Original Message-----
> > From: bioperl-l-bounces at portal.open-bio.org
> [mailto:bioperl-l-bounces at portal.open-bio.org] On Behalf Of Aaron J. Mackey
> > Sent: 14 October 2004 21:27
> > To: Bioperl
> > Subject: [Bioperl-l] make test!!
> > Importance: High
> >
> >
> > I've had only a very few people send me feedback about the current
> > state of bioperl-live "make test" on your favorite
> > old/crotchety/obscure platforms. I'm writing the Change log and
> > thinking about branching, but I'm an experimentalist, I need data!
> >
> > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure
> > you have everything, "make distclean" if you've built from the cvs
> > checkout before, and start from scratch with the usual litany: perl
> > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron.
> >
> > Setting BIOPERLDEBUG is very noisy, but it's the end result I care
> > about, not so much all the verbiage (unless there's specific verbiage
> > related to the end result ...)
> >
> > Thanks,
> >
> > -Aaron
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > ---
> > avast! Antivirus: Inbound message clean.
> > Virus Database (VPS): 0442-2, 14/10/2004
> > Tested on: 14/10/2004 21:59:20
> > avast! is copyright (c) 2000-2003 ALWIL Software.
> > http://www.avast.com
> >
> >
>
> ---
> avast! Antivirus: Outbound message clean.
> Virus Database (VPS): 0442-3, 15/10/2004
> Tested on: 20/10/2004 15:20:04
> avast! is copyright (c) 2000-2003 ALWIL Software.
> http://www.avast.com
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
> ---
> avast! Antivirus: Inbound message clean.
> Virus Database (VPS): 0442-3, 15/10/2004
> Tested on: 21/10/2004 07:12:10
> avast! is copyright (c) 2000-2003 ALWIL Software.
> http://www.avast.com
>
>
---
avast! Antivirus: Outbound message clean.
Virus Database (VPS): 0443-1, 20/10/2004
Tested on: 21/10/2004 12:58:59
avast! is copyright (c) 2000-2003 ALWIL Software.
http://www.avast.com
-------------- next part --------------
Failed Test Stat Wstat Total Fail Failed List of Failed
-------------------------------------------------------------------------------
t\ESEfinder.t 5 1280 12 10 83.33% 3-12
t\Index.t 22 5632 41 21 51.22% 21-41
t\ProtPsm.t 1 ?? % ??
t\Registry.t 255 65280 11 8 72.73% 4-11
t\primaryqual.t 255 65280 31 0 0.00% ??
t\seqread_fail.t 255 65280 13 0 0.00% ??
2 subtests skipped.
Failed 6/193 test scripts, 96.89% okay. 35/8919 subtests failed, 99.61% okay.
NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff'
Stop.
NOTES:
------
ESEfinder.t causes my perl to crash
Particulars:
------------
t\Biblio_biofetch............ok 1/11Warning: Couldn't connect to BioFetch server with Bio::DB::Medline.pm!
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: retrieval type pipeline unsupported
STACK: Error::throw
STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl
ib\lib/Bio/Root/Root.pm:328
STACK: Bio::DB::Biblio::biofetch::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbi
operl-live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:237
STACK: Bio::DB::DBFetch::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l
ive-debug\blib\lib/Bio/DB/DBFetch.pm:194
STACK: Bio::DB::Biblio::biofetch::get_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl
-live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:153
STACK: t\Biblio_biofetch.t:71
-----------------------------------------------------------
t\ESEfinder..................dubious
Test returned status 5 (wstat 1280, 0x500)
DIED. FAILED tests 3-12
Failed 10/12 tests, 16.67% okay
t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 126, <GEN6> line
54.
t\Index......................dubious
Test returned status 22 (wstat 5632, 0x1600)
DIED. FAILED tests 21-41
Failed 21/41 tests, 48.78% okay
t\primaryqual................dubious
Test returned status 255 (wstat 65280, 0xff00)
after all the subtests completed successfully
t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok, expected 1
t\Registry...................ok 2/11This Perl doesn't implement function getpwuid(). Skipping...
-------------------- WARNING ---------------------
MSG: No seqdatabase.ini file found in ~/.bioinformatics/
nor in /etc/bioinformatics/ nor in directory specified by
t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from
http://www.open-bio.org/registry/seqdatabase.ini
---------------------------------------------------
-------------------- WARNING ---------------------
MSG: Stored the default registry configuration in
/.bioinformatics/seqdatabase.ini
---------------------------------------------------
t\Registry...................NOK 5
-------------------- WARNING ---------------------
MSG: No database with name testflat in Registry
---------------------------------------------------
Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line 66, <FH> line 11.
t\Registry...................dubious
Test returned status 255 (wstat 65280, 0xff00)
DIED. FAILED tests 4-11
Failed 8/11 tests, 27.27% okay
t\SeqIO......................ok 196/284
-------------------- WARNING ---------------------
MSG: Bio::PrimarySeq=HASH(0x2a9363c) is not a SeqI compliant sequence object!
STACK Bio::SeqIO::embl::write_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
g\blib\lib/Bio\SeqIO\embl.pm:410
STACK toplevel t\SeqIO.t:527
t\SeqIO......................ok 198/284
t\SeqIO......................ok 199/284-------------------- WARNING ---------------------
MSG: test is not a SeqI compliant sequence object!
STACK Bio::SeqIO::embl::write_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
g\blib\lib/Bio\SeqIO\embl.pm:410
STACK (eval) t\SeqIO.t:530
STACK toplevel t\SeqIO.t:529
t\SeqIO......................ok 253/284Location parse, processing 1..105
Location parse, processing <1..>105
Location parse, processing 69^70
Location parse, processing 103^102
t\SeqIO......................ok 259/284
-------------------- WARNING ---------------------
MSG: When building a location, start (103) is expected to be less than end (102), however it was not. Switching start
and end and setting strand to -1
STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
\blib\lib/Bio/Location/Atomic.pm:104
STACK Bio::Location::Simple::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
\blib\lib/Bio\Location\Simple.pm:91
STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
t\SeqIO......................ok 262/284STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Softwa
re\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
FTHelper.pm:124
STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
STACK Bio::SeqIO::genbank::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-de
bug\blib\lib/Bio\SeqIO\genbank.pm:488
STACK (eval) t\SeqIO.t:681
STACK toplevel t\SeqIO.t:680
t\seqread_fail...............ok 1/13
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:
XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession].
STACK: Error::throw
STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl
ib\lib/Bio/Root/Root.pm:328
STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-
live-debug\blib\lib/Bio/DB/BioFetch.pm:406
STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l
ive-debug\blib\lib/Bio/DB/WebDBSeqI.pm:525
STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl
-live-debug\blib\lib/Bio/DB/WebDBSeqI.pm:287
STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li
ve-debug\blib\lib/Bio/DB/WebDBSeqI.pm:153
STACK: main::fetch t\seqread_fail.t:69
STACK: t\seqread_fail.t:81
-----------------------------------------------------------
t\seqread_fail...............dubious
Test returned status 255 (wstat 65280, 0xff00)
after all the subtests completed successfully
t\Swiss......................ok 2/5Location parse, processing 1..?
-------------------- WARNING ---------------------
MSG: could not find a valid fuzzy encoding for ?
STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope
rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554
STACK Bio::Location::Fuzzy::end K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
blib\lib/Bio\Location\Fuzzy.pm:254
STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
\blib\lib/Bio/Location/Atomic.pm:101
STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
blib\lib/Bio/Location/Fuzzy.pm:139
STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof
bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
FTHelper.pm:124
STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
g\blib\lib/Bio\SeqIO\swiss.pm:326
STACK toplevel t\Swiss.t:47
Location parse, processing ?..409
-------------------- WARNING ---------------------
MSG: could not find a valid fuzzy encoding for ?
STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope
rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554
STACK Bio::Location::Fuzzy::start K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
g\blib\lib/Bio\Location\Fuzzy.pm:229
STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
\blib\lib/Bio/Location/Atomic.pm:100
STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
blib\lib/Bio\Location\Fuzzy.pm:139
STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof
bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
FTHelper.pm:124
STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
g\blib\lib/Bio\SeqIO\swiss.pm:326
STACK toplevel t\Swiss.t:47
Location parse, processing 388..388
Location parse, processing 1..?
-------------------- WARNING ---------------------
MSG: could not find a valid fuzzy encoding for ?
STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope
rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554
STACK Bio::Location::Fuzzy::end K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
blib\lib/Bio\Location\Fuzzy.pm:254
STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
\blib\lib/Bio/Location/Atomic.pm:101
STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
blib\lib/Bio\Location\Fuzzy.pm:139
STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof
bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
FTHelper.pm:124
STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
g\blib\lib/Bio\SeqIO\swiss.pm:326
STACK toplevel t\Swiss.t:62
Location parse, processing ?..409
-------------------- WARNING ---------------------
MSG: could not find a valid fuzzy encoding for ?
STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope
rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554
STACK Bio::Location::Fuzzy::start K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
g\blib\lib/Bio\Location\Fuzzy.pm:229
STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug
\blib\lib/Bio/Location/Atomic.pm:100
STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\
blib\lib/Bio\Location\Fuzzy.pm:139
STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co
pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218
STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof
bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157
STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/
FTHelper.pm:124
STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio
perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123
STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu
g\blib\lib/Bio\SeqIO\swiss.pm:326
STACK toplevel t\Swiss.t:62
Location parse, processing 388..388
t\Swiss......................ok
-------------- next part --------------
Failed Test Stat Wstat Total Fail Failed List of Failed
-------------------------------------------------------------------------------
t\Index.t 22 5632 41 21 51.22% 21-41
t\ProtPsm.t 1 ?? % ??
t\Registry.t 255 65280 11 8 72.73% 4-11
t\primaryqual.t 255 65280 31 0 0.00% ??
t\seqread_fail.t 255 65280 13 0 0.00% ??
115 subtests skipped.
Failed 5/193 test scripts, 97.41% okay. 25/8919 subtests failed, 99.72% okay.
NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff'
Stop.
NOTES:
------
plan tests in ProtPsm needs to be changed to 5?
Particulars:
------------
t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 126, <GEN6> line
54.
t\Index......................dubious
Test returned status 22 (wstat 5632, 0x1600)
DIED. FAILED tests 21-41
Failed 21/41 tests, 48.78% okay
t\primaryqual................dubious
Test returned status 255 (wstat 65280, 0xff00)
after all the subtests completed successfully
t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok, expected 1
t\Registry...................ok 2/11This Perl doesn't implement function getpwuid(). Skipping...
-------------------- WARNING ---------------------
MSG: No seqdatabase.ini file found in ~/.bioinformatics/
nor in /etc/bioinformatics/ nor in directory specified by
t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from
http://www.open-bio.org/registry/seqdatabase.ini
---------------------------------------------------
-------------------- WARNING ---------------------
MSG: Stored the default registry configuration in
/.bioinformatics/seqdatabase.ini
---------------------------------------------------
t\Registry...................ok 3/11
t\Registry...................NOK 5-------------------- WARNING ---------------------
MSG: No database with name testflat in Registry
---------------------------------------------------
Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line 66, <FH> line 11.
t\Registry...................dubious
Test returned status 255 (wstat 65280, 0xff00)
DIED. FAILED tests 4-11
t\seqread_fail...............ok 1/13
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id:
XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession].
STACK: Error::throw
STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live\blib\lib
/Bio/Root/Root.pm:328
STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-
live\blib\lib/Bio/DB/BioFetch.pm:406
STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l
ive\blib\lib/Bio/DB/WebDBSeqI.pm:525
STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl
-live\blib\lib/Bio/DB/WebDBSeqI.pm:287
STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li
ve\blib\lib/Bio/DB/WebDBSeqI.pm:153
STACK: main::fetch t\seqread_fail.t:69
STACK: t\seqread_fail.t:81
-----------------------------------------------------------
t\seqread_fail...............dubious
Test returned status 255 (wstat 65280, 0xff00)
after all the subtests completed successfully
-------------- next part --------------
perl -I. -w t/ESEfinder.t
-------------------------
1..12
error is 0
ok 1
ok 2
$Bio::Tools::Analysis::DNA::ESEfinder=HASH(0x1db571c) = bless( {
'max_redirect' => 7,
'protocols_forbidden' => undef,
'no_proxy' => [],
'_RESULT_SPEC' => {
'' => 'bulk',
'Bio::SeqFeatureI' => 'ARRAY of B
io::SeqFeature::Generic',
'all' => 'Bio::Seq::Meta::Array o
bject',
'raw' => 'Array of [ SRprotein, p
osition , motif,score]'
},
'_url' => 'http://exon.cshl.org/cgi-bin/ESE/esefinder
.cgi',
'_ANALYSIS_NAME' => 'ESEfinder',
'_INPUT_SPEC' => [
{
'name' => 'sequence',
'type' => 'Bio::PrimarySeqI',
'mandatory' => 'true'
}
],
'protocols_allowed' => undef,
'_ANALYSIS_SPEC' => {
'supplier' => 'Krainer lab, Col
d Spring Harbor Laboratory, POBOX100, Bungtown Rd, COld Spring Harbor, NY, USA',
'version' => '2.0',
'name' => 'ESEfinder',
'type' => 'DNA',
'description' => 'to identify e
xonic splicing elements in human transcripts'
},
'_seq' => bless( {
'display_id' => 'bioperl',
'_seq_length' => undef,
'_root_verbose' => 0,
'seq' => 'atcgatgctatgcatgctatgggt
gtgattcgatgcgactgttcatcgtagccccccccccccccctttt',
'alphabet' => 'dna'
}, 'Bio::PrimarySeq' ),
'use_eval' => 1,
'requests_redirectable' => [
'GET',
'HEAD'
],
'from' => undef,
'timeout' => 180,
'agent' => 'libwww-perl/5.800',
'_root_verbose' => '1',
'def_headers' => undef,
'parse_head' => 1,
'proxy' => undef,
'max_size' => undef
}, 'Bio::Tools::Analysis::DNA::ESEfinder' );
>bioperl
atcgatgctatgcatgctatgggtgtgattcgatgcgactgttcatcgtagccccccccc
cccccctttt
ok 3
Subroutine new redefined at Bio\Location\Simple.pm line 89, <GEN3> line 31.
Subroutine start redefined at Bio\Location\Simple.pm line 111, <GEN3> line 31.
Subroutine end redefined at Bio\Location\Simple.pm line 137, <GEN3> line 31.
Subroutine length redefined at Bio\Location\Simple.pm line 174, <GEN3> line 31.
Subroutine location_type redefined at Bio\Location\Simple.pm line 265, <GEN3> line 31.
Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, <GEN3> line 31.
Subroutine trunc redefined at Bio\Location\Simple.pm line 343, <GEN3> line 31.
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
perl -I. -w t/Index.t
---------------------
1..41
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
Subroutine new redefined at Bio\Location\Simple.pm line 89, <GEN4> line 87.
Subroutine start redefined at Bio\Location\Simple.pm line 111, <GEN4> line 87.
Subroutine end redefined at Bio\Location\Simple.pm line 137, <GEN4> line 87.
Subroutine length redefined at Bio\Location\Simple.pm line 174, <GEN4> line 87.
Subroutine location_type redefined at Bio\Location\Simple.pm line 265, <GEN4> line 87.
Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, <GEN4> line 87.
Subroutine trunc redefined at Bio\Location\Simple.pm line 343, <GEN4> line 87.
Subroutine new redefined at Bio\Location\Fuzzy.pm line 137, <GEN4> line 92.
Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 164, <GEN4> line 92.
Subroutine start redefined at Bio\Location\Fuzzy.pm line 226, <GEN4> line 92.
Subroutine end redefined at Bio\Location\Fuzzy.pm line 251, <GEN4> line 92.
Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 276, <GEN4> line 92.
Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 295, <GEN4> line 92.
Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 315, <GEN4> line 92.
Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 344, <GEN4> line 92.
Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 363, <GEN4> line 92.
Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 383, <GEN4> line 92.
Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 450, <GEN4> line 92.
Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 537, <GEN4> line 92.
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
not ok 21
# Failed test 21 in t/Index.t at line 118
not ok 22
# Failed test 22 in t/Index.t at line 125
Can't call method "length" on an undefined value at t/Index.t line 126, <GEN6> line 54.
perl -I. -w t/ProtPsm.t
-----------------------
1..1
Can't locate package Bio::Matrix::PSM::ProtMatrix for @Bio::Matrix::PSM::ProtPsm::ISA at t/ProtPsm.t line 22.
ok 1
ok 2
ok 3
ok 4
ok 5
perl -I. -w t/Registry.t
------------------------
1..11
ok 1
ok 2
This Perl doesn't implement function getpwuid(). Skipping...
-------------------- WARNING ---------------------
MSG: No seqdatabase.ini file found in ~/.bioinformatics/
nor in /etc/bioinformatics/ nor in directory specified by
t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from
http://www.open-bio.org/registry/seqdatabase.ini
---------------------------------------------------
-------------------- WARNING ---------------------
MSG: Stored the default registry configuration in
/.bioinformatics/seqdatabase.ini
---------------------------------------------------
ok 3
not ok 4
# Failed test 4 in t/Registry.t at line 61
not ok 5
# Failed test 5 in t/Registry.t at line 63
-------------------- WARNING ---------------------
MSG: No database with name testflat in Registry
---------------------------------------------------
not ok 6
# Failed test 6 in t/Registry.t at line 65
Can't call method "get_Seq_by_id" on an undefined value at t/Registry.t line 66, <FH> line 11.
perl -I. -w t/primaryqual.t
---------------------------
# lots of output then:
Can't locate object method "header" via package "Bio::Seq::SeqWithQuality" at Bio\SeqIO\qual.pm line 211, <GEN0> line
1.
More information about the Bioperl-l
mailing list