[Bioperl-l] Deprecating

[Brian Osborne]

Stefan,

Done, we hope. AlignIO/meme.pm passes its tests whether or not there's a
strand column. Now if you'd like to put it through its paces with real
scripts that would certainly help, but for the moment I can't do much more,
and the Alignment objects look reasonable in the debugger.

Brian O.


-----Original Message-----
From: Stefan Kirov [mailto:skirov at utk.edu]
Sent: Saturday, October 16, 2004 4:41 PM
To: Brian Osborne
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] Deprecating

Brian,
My question is if we need another meme parser? If you think this is
necessary I can add them...
What do you think?
Stefan

Brian Osborne wrote:

>Stefan,
>
>If you want to help with meme tests just add them to AlignIO.t, it's the
>section at the end.
>
>Brian O.
>
>
>-----Original Message-----
>From: Stefan Kirov [mailto:skirov at utk.edu]
>Sent: Saturday, October 16, 2004 11:41 AM
>To: Brian Osborne
>Cc: bioperl-l at bioperl.org
>Subject: Re: [Bioperl-l] Deprecating
>
>Brian,
>
>Brian Osborne wrote:
>
>
>
>>Stefan,
>>
>>I took a look at AlignIO/meme.pm and fixed some obvious problems but I
>>
>>
>think
>
>
>>it's possible that the file used in the tests, t/data/meme.dat, may not
>>
>>
>have
>
>
>>all the information I need to debug the module (and I don't have meme
>>myself).
>>
>>
>>
>I don't think there were tests for AlignIO/meme.pm. Anyway id there are
>I am not able to find these. t/data/meme.dat is a test file for
>Bio/Matrix/PSM/IO/meme.pm. But as this is presumably the same format
>AlignIO/meme.pm should read....
>
>
>
>>Question: is "strand" ever stipulated in the meme output file?
>>There's no "+" or "-" indicated in meme.dat. This file is the result of an
>>analysis of DNA, so I'm a bit surprised not to see some indication of
>>
>>
>strand
>
>
>>(and the code, before I modified it, was using a regexp that attempted to
>>capture strand information). Can you enlighten me here? Here's one of the
>>relevant sections:
>>
>>
>>Sequence name             Start   P-value                      Site
>>-------------             ----- ---------            ---------------------
-
>>
>>
>-
>
>
>>--
>>6603                       1311  2.59e-15 GGCGCATTGA
>>CAGAAAAATTGAATTCCCACCCCCC AATGAGGAGG
>>83796                      1284  2.59e-15 GGAGGATTGA
>>CAGAAAAATTGAATTCCCACCCCCC AACGAGGAGG
>>20218                       938  6.34e-12 TTTTTGGTAA
>>CCTTAAAATAAAATCCCCACCACCA CTTTTAAAAA
>>10657                      1685  8.70e-12 GGCCCGCGCG
>>CAGACAAAGACATTCCACAGCTCCC GCCCCCTCCA
>>
>>Perhaps when one runs meme with DNA one can tell it to just do 1 strand,
>>rather than both?
>>
>>
>>
>You are quite right on this. I had somewhere an example with strands...
>I'll find it (or regenrate it) ASAP and send it to you. I will try to
>rewrite the tests for meme (other one) for the new test file.
>
>
>
>>This would explain the absence of strand information, but
>>it means the regexp changes depending on this mode. Again, I don't have
>>
>>
>meme
>
>
>>or use meme, so you're going to have to tell me, or send me output files
>>with and without strand stipulation.
>>
>>Brian O.
>>
>>-----Original Message-----
>>From: Stefan Kirov [mailto:skirov at utk.edu]
>>Sent: Friday, October 15, 2004 6:33 PM
>>To: Brian Osborne
>>Cc: bioperl-l at bioperl.org
>>Subject: Re: [Bioperl-l] Deprecating
>>
>>I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it
>>did not work for me and I have not seen anyone committing changes....
>>Stefan
>>
>>Brian Osborne wrote:
>>
>>
>>
>>
>>
>>>Bioperl-l,
>>>
>>>Any objections to my adding Bio::Tools::RestrictionEnzyme to the
>>>
>>>
>DEPRECATED
>
>
>>>file? It was replaced by Bio::Restriction a while ago.
>>>
>>>Along the same lines, is there anything else that should be deprecated?
>>>Bio::Tools::GFF?
>>>
>>>Brian O.
>>>
>>>
>>>
>>>
>>>_______________________________________________
>>>Bioperl-l mailing list
>>>Bioperl-l at portal.open-bio.org
>>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>>
>>>
>>>
>>>
>>--
>>Stefan Kirov, Ph.D.
>>University of Tennessee/Oak Ridge National Laboratory
>>5700 bldg, PO BOX 2008 MS6164
>>Oak Ridge TN 37831-6164
>>USA
>>tel +865 576 5120
>>fax +865-576-5332
>>e-mail: skirov at utk.edu
>>sao at ornl.gov
>>
>>"And the wars go on with brainwashed pride
>>For the love of God and our human rights
>>And all these things are swept aside"
>>
>>
>>
>>
>>
>>
>
>--
>Stefan Kirov, Ph.D.
>University of Tennessee/Oak Ridge National Laboratory
>5700 bldg, PO BOX 2008 MS6164
>Oak Ridge TN 37831-6164
>USA
>tel +865 576 5120
>fax +865-576-5332
>e-mail: skirov at utk.edu
>sao at ornl.gov
>
>"And the wars go on with brainwashed pride
>For the love of God and our human rights
>And all these things are swept aside"
>
>
>
>

--
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov at utk.edu
sao at ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"