[Bioperl-l] Deprecating

[Brian Osborne]

Stefan,

I took a look at AlignIO/meme.pm and fixed some obvious problems but I think
it's possible that the file used in the tests, t/data/meme.dat, may not have
all the information I need to debug the module (and I don't have meme
myself). Question: is "strand" ever stipulated in the meme output file?
There's no "+" or "-" indicated in meme.dat. This file is the result of an
analysis of DNA, so I'm a bit surprised not to see some indication of strand
(and the code, before I modified it, was using a regexp that attempted to
capture strand information). Can you enlighten me here? Here's one of the
relevant sections:


Sequence name             Start   P-value                      Site
-------------             ----- ---------            -----------------------
--
6603                       1311  2.59e-15 GGCGCATTGA
CAGAAAAATTGAATTCCCACCCCCC AATGAGGAGG
83796                      1284  2.59e-15 GGAGGATTGA
CAGAAAAATTGAATTCCCACCCCCC AACGAGGAGG
20218                       938  6.34e-12 TTTTTGGTAA
CCTTAAAATAAAATCCCCACCACCA CTTTTAAAAA
10657                      1685  8.70e-12 GGCCCGCGCG
CAGACAAAGACATTCCACAGCTCCC GCCCCCTCCA

Perhaps when one runs meme with DNA one can tell it to just do 1 strand,
rather than both? This would explain the absence of strand information, but
it means the regexp changes depending on this mode. Again, I don't have meme
or use meme, so you're going to have to tell me, or send me output files
with and without strand stipulation.

Brian O.

-----Original Message-----
From: Stefan Kirov [mailto:skirov at utk.edu]
Sent: Friday, October 15, 2004 6:33 PM
To: Brian Osborne
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] Deprecating

I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it
did not work for me and I have not seen anyone committing changes....
Stefan

Brian Osborne wrote:

>Bioperl-l,
>
>Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED
>file? It was replaced by Bio::Restriction a while ago.
>
>Along the same lines, is there anything else that should be deprecated?
>Bio::Tools::GFF?
>
>Brian O.
>
>
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l at portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>

--
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov at utk.edu
sao at ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"