[Bioperl-l] Using Bioperl BLAST with a cgi script

[boileau@essi.fr]

Hi, i'm kind of new to Bioperl (and Perl also), but maybe someone out
there will be able to answer my question. I have a script that does a
blast. It works well when i use it as a simply script, but when I try to
call as a cgi, it doesn't. The web server error message is "cannot find
path to blastall".Below is the code of the script.
Thanks to anyone who will be able to help me!

William Boileau


-- SCRIPT SOURCE --

$table_cible = "Homo_sapiens.cdna.fa";
$sequence_cible =
'GGCCCCTGCCAGGGCCCTGCTACATGCGAGCACTGTCCCCCAGGCCTGGGTACCAGTCCTCCTGGGCATCGAGGCCCATCTCCACAGCAGAGTATGCCCTCCTCTACCACACCCTGCAGGAAGCCACCAAGCCCCTGCATCAGTTCTTCCT';@params = ('database' => $table_cible, 'outfile' => 'blast.out',
'program' => 'blastn', 'b' => 1, '_READMETHOD'=>'Blast');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);

$input = Bio::Seq->new(-id=>"test query", -seq => $sequence_cible);
$blast_report = $factory->blastall($input);

$searchio = new Bio::SearchIO ('-format' => 'blast','-file' =>
'blast.out');

$result = $searchio->next_result;
@statnames = $result->available_statistics;