[Bioperl-l] Bio::DB::Fasta
Heikki Lehvaslaiho
heikki at nildram.co.uk
Fri Dec 19 07:33:42 EST 2003
Eric,
Thanks for the error report. Jason hinted earlier that he saw similar problems
in that module.
Lincoln, do you have time to have go at this before Monday?
-Heikki
On Thursday 18 Dec 2003 11:00 pm, Eric Just wrote:
> Hi I have 2 points about Bio::DB::Fasta
>
> 1. In windows it seems that the file being indexed needs to have unix style
> line breaks. WIndows style does not work.
>
> I have attempted to retreive a subsequence of a genomic sequence file in a
> database. To compare I used a seq object created through SeqIO. I got tow
> seqs of different lenghths. The one gotten from SeqIO is what I was
> expecting.
>
> use Bio::DB::Fasta;
> use Bio::Seq;
> use Bio::SeqIO;
>
> my $db = Bio::DB::Fasta->new('C:/dicty/bin/blast_scripts/fasta');
> my $prim = $db->get_Seq_by_id('DDB0183747');
> my $fasta = new Bio::SeqIO( -file =>
> 'C:/dicty/bin/blast_scripts/fasta/dictyChromosome6.fa', -format =>
> 'Fasta'); my $seq = $fasta->next_seq();
>
> print Dumper( $seq->subseq(1001,1025 ));
> print Dumper( $prim->subseq(1001,1025 ));
>
> ------------------------output------------------------------------------
>
> $VAR1 = 'ATAAATCAAATTGTTTTTTAGTTTT';
> $VAR1 = 'NNNNNNNNNNNNNNNNATAAATCAAA';
>
> 2. If I save the file with unix style line breaks it is better but I still
> get a different sequence than I do for SeqIO: It seems to be offset by 1.
>
> ------------------------output------------------------------------------
>
> $VAR1 = 'ATAAATCAAATTGTTTTTTAGTTTT';
> $VAR1 = 'TAAATCAAATTGTTTTTTAGTTTTT';
>
> I am using the latest version of Bio::DB::Fasta (downloaded from cvs tree)
> in bioperl 1.2. and DB_File 1.807 (from ppm).
>
> Thanks for any help/suggestions.
>
> Eric
>
>
>
>
> ============================================
>
> Eric Just
> e-just at northwestern.edu
> dictyBase Programmer
> Center for Genetic Medicine
> Northwestern University
> http://dictybase.org
>
> ============================================
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
--
______ _/ _/_____________________________________________________
_/ _/ http://www.ebi.ac.uk/mutations/
_/ _/ _/ Heikki Lehvaslaiho heikki_at_ebi ac uk
_/_/_/_/_/ EMBL Outstation, European Bioinformatics Institute
_/ _/ _/ Wellcome Trust Genome Campus, Hinxton
_/ _/ _/ Cambs. CB10 1SD, United Kingdom
_/ Phone: +44 (0)1223 494 644 FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________
More information about the Bioperl-l
mailing list