[Bioperl-l] Bio::DB::Fasta

[Heikki Lehvaslaiho]

Eric,

Thanks for the error report. Jason hinted earlier that he saw similar problems 
in that module.

Lincoln, do you have time to have go at this before Monday?

	-Heikki


On Thursday 18 Dec 2003 11:00 pm, Eric Just wrote:
> Hi I have 2 points about Bio::DB::Fasta
>
> 1. In windows it seems that the file being indexed needs to have unix style
> line breaks. WIndows style does not work.
>
> I have attempted to retreive a subsequence of a genomic sequence file in a
> database.  To compare I used a seq object created through SeqIO.  I got tow
> seqs of different lenghths.  The one gotten from SeqIO is what I was
> expecting.
>
> use Bio::DB::Fasta;
> use Bio::Seq;
> use Bio::SeqIO;
>
> my $db      = Bio::DB::Fasta->new('C:/dicty/bin/blast_scripts/fasta');
> my $prim   = $db->get_Seq_by_id('DDB0183747');
> my $fasta  = new Bio::SeqIO( -file =>
> 'C:/dicty/bin/blast_scripts/fasta/dictyChromosome6.fa', -format =>
> 'Fasta'); my $seq    = $fasta->next_seq();
>
>   print Dumper( $seq->subseq(1001,1025 ));
>   print Dumper( $prim->subseq(1001,1025 ));
>
> ------------------------output------------------------------------------
>
> $VAR1 = 'ATAAATCAAATTGTTTTTTAGTTTT';
> $VAR1 = 'NNNNNNNNNNNNNNNNATAAATCAAA';
>
> 2. If I save the file with unix style line breaks it is better but I still
> get a different sequence than I do for SeqIO:  It seems to be offset by 1.
>
> ------------------------output------------------------------------------
>
> $VAR1 = 'ATAAATCAAATTGTTTTTTAGTTTT';
> $VAR1 = 'TAAATCAAATTGTTTTTTAGTTTTT';
>
> I am using the latest version of Bio::DB::Fasta (downloaded from cvs tree)
> in bioperl 1.2.   and DB_File 1.807 (from ppm).
>
> Thanks for any help/suggestions.
>
> Eric
>
>
>
>
> ============================================
>
> Eric Just
> e-just at northwestern.edu
> dictyBase Programmer
> Center for Genetic Medicine
> Northwestern University
> http://dictybase.org
>
> ============================================
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/                      http://www.ebi.ac.uk/mutations/
     _/  _/  _/  Heikki Lehvaslaiho    heikki_at_ebi ac uk
    _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
   _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
  _/  _/  _/  Cambs. CB10 1SD, United Kingdom
     _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________