[Bioperl-l] Re: "Too many files open" with bl2seq

[Steven Cannon]

Peter:

To second your '"Too many files open" with bl2seq' question, I noticed 
something similar last month when trying to use bl2seq via bioperl. So, 
apologies for re-posting, but maybe the extra details will help someone 
spot the glitch. I see a different set of errors (MSG:  No hit object 
found for bl2seq report  ... etc.) , but perhaps the underlying cause is 
the same.

Steve Cannon

Begin forwarded message:

> From: Steven Cannon <cann0010 at tc.umn.edu>
> Date: Fri Mar 14, 2003  10:01:43 AM US/Central
> To: bioperl-l at bioperl.org
> Subject: more on the bl2seq error
>
> Hello,
>
> Here is a bit more information on the bl2seq error that I described on 
> March 12. It does genuinely seem to be data-independent. Here is a very 
> minimal script that produces the problem: blast a sequence (protein or 
> nucleotide) against itself 300 times. The crash occurs near hit 250 
> (I've also seen 247, 248, and 249, in different program contexts). 
> Again: this is in Bioperl 1.02 and 1.2, on OS X .
>
> use strict;
> use Bio::SeqIO;
> use Bio::Tools::BPbl2seq;
> use Bio::Tools::Run::StandAloneBlast;
> my $seq1 = Bio::Seq->new(
>   '-id'=>"seq1",
>   
> '-seq'=>"atcgttcgaataccggcttaagctagtctgcattaaggctggaaccatcgttcnaataccgg"
> );
> my $factory = Bio::Tools::Run::StandAloneBlast->new('program' => 
> 'blastn');
> my $counter = 0;
> for (my $i = 0; $i < 300; $i++) {
>   $counter++;
>   my $bl2seq_report = $factory->bl2seq($seq1, $seq1);
>   my $hsp = $bl2seq_report->next_feature; # report only the top HSP
>   my $P = $hsp->P;
>   print "$counter $P\n";
> }
>
> =item
>
> Error:
>
> 248 1e-32
> 249 1e-32
> [bl2seq] WARNING:  [000.000]  Unable to open BLOSUM62
> [bl2seq] WARNING:  [000.000]  BlastScoreBlkMatFill returned non-zero 
> status
> [bl2seq] WARNING:  [000.000]  SetUpBlastSearch failed.
>
> ------------- EXCEPTION  -------------
> MSG:  No hit object found for bl2seq report
>
> STACK Bio::Tools::BPbl2seq::next_feature 
> /Library/Perl/Bio/Tools/BPbl2seq.pm:231
> STACK toplevel 
> /Users/steven/scperl2/ProgramControl/bl2seq/bl2seq0.02d_test.pl:20
>
> --------------------------------------
>