[Bioperl-l] problem with Bio::Seq objects
Dan Kortschak
Dan Kortschak <kortschak@rsbs.anu.edu.au>
Thu, 25 Jul 2002 13:44:28 +1000 (EST)
I have just started using BioPerl (and OO perl in general though have been
using perl for a couple of years) and I find that I am unable to
consistently call methods to Bio::Seq objects (see example from the dist's
example directory below - the same problem occurs in my own scripts).
The situation is that either the call doesn't work at all, or it works
once and then fails the second time.
Can anyone help or explain what is going on?
BioPerl on my box is installed as the debian package from woody - though
the following problem also occurs with the CPAN installation of BioPerl
1.0.2.
thanks
Dan Kortschak
[/usr/share/doc/bioperl/examples:628]
# perl -w getGenBank.pl
>MUSIGHBA1 Mouse Ig active H-chain V-region from MOPC21, subgroup VH-II, mRNA.
AGGCTCAATTTAGTTTTCCTTGTCCTTATTTTAAAAGGTGTCCAGTGTGATGTGCAGCTG
GTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCC
TCTGGATTCACTTTCAGTAGCTTTGGAATGCACTGGGTTCGTCAGGCTCCAGAGAAGGGG
CTGGAGTGGGTCGCATACATTAGTAGTGGCAGTAGTACCCTCCACTATGCAGACACAGTG
AAGGGCCGATTCACCATCTCAAGAGACAATCCCAAGAACACCCTGTTCCTGCAAATGACC
AGTCTAAGGTCTGAGGACACGGCCATGTATTACTGTGCAAGATGGGGTAACTACCCTTAC
TATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA
Can't call method "seq" on an undefined value at /usr/share/perl5/Bio/SeqIO/fasta.pm line 166.
--
_____________________________________________________________ .`.`o
o| ,\__ `./`r
Dan Kortschak kortschak@rsbs.anu.spanner.edu.au <\/ \_O> O
"|`...'.\
Before you criticise a man, try to walk a mile in his ` :\
shoes. Then, if he doesn't like what you have to say, : \
you'll be a mile away, and you'll have his shoes. : \
The address above will not work, remove the spanner from the works.
By replying to this email you implicitly accept that your response may
be forwarded to other recipients.
Permission is granted for fair use reproduction.