[Biojava-l] translation and leucine

[François Le Fèvre]

Dear all,
i have a quick question about translation with biojava 3

I would like to retrieve that the codon CTA is coding for a leucine.
But some leucine codons code also for a start in Universal Genetic code

Here I have build a very short example:
given  a short dna sequence coomposed of a start codon and 6 leucine codons

TranscriptionEngine e = TranscriptionEngine.getDefault();
DNASequence dd = new DNASequence("ATGTTGTTACTTCTCCTACTG");
//return MLLLLLL : OK

DNASequence dd = new DNASequence("CTATTGTTACTTCTCCTACTG");
//return MLLLLLL : KO I would prefer have LLLLLLL !

DNASequence dd = new DNASequence("CTA");
//return M : KO I would prefer have L !

Could someone explain me this feature ?
How the default transcritionEngine works?

How can I ask to the TranscriptionEngine give me the aminoacids 
corresponding to CTA when it is not in first position?

Thanks a lot for your help !

Francois