[Biojava-dev] Displaying Blast Alignments

[Tim Troup]

Hi Mark,

Thanks for the reply. I was thinking about implementing it that way but 
then I thought wait a minute this information is already in the file why 
do i have to re-calculate it all again. I was hoping that this information 
was captured by a class and i could access it somehow. I had a look 
through the API but couldn't find anything that fitted the bill.

So i guess my question is does the API support printing of the alignment 
(as it si displayed in the original blast file output) without having to 
do this re-calculation step?

Thanks again, 

Tim


On Mon, 28 Jul 2003, Schreiber, Mark wrote:

> In the case of DNA you could symply test that seq1.symbolAt(i) ==
> seq2.symbolAt(i), unfortunately this will not work so well for protein.
> 
> - Mark
> 
> 
> > -----Original Message-----
> > From: Tim Troup [mailto:troup at dcs.gla.ac.uk] 
> > Sent: Monday, 28 July 2003 7:53 a.m.
> > To: biojava-dev at biojava.org
> > Subject: [Biojava-dev] Displaying Blast Alignments
> > 
> > 
> > Hi,
> > 
> > I have been using the Blast parser code from the "BioJava In Anger" 
> > cookbook:
> > 
> > http://www.biojava.org/docs/bj_in_anger/BlastParser.htm
> > 
> > I tried to extend this code such that it would also print out the 
> > alignments. I thought this could be achieved by iterating 
> > through all the 
> > sub-hits, obtaining the Alignment object and printing out the 
> > SymbolLists. 
> > However by doing this you do not get the | symbols indicating 
> > an exact 
> > match between the two sequences as you would in the original 
> > blast file e.g.
> > 
> > 
> > Instead of this:
> > 
> > Query: 2352 
> > cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
> >             
> > |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
> > Sbjct: 2202 
> > cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 2261
> > 
> > 
> > 
> > you end up with this:
> > 
> > Query: 2352 
> > cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
> > 
> > Sbjct: 2202 
> > cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 2261
> > 
> > 
> > 
> > 
> > Is there any way i can easily display the alignment as it is 
> > displayed in the original blast file? 
> > 
> > 
> > Thanks, Tim Troup
> > 
> > -- 
> > 
> > 
> > *********************************
> > Tim Troup
> > Room F151
> > 17 Lilybank Gardens
> > Department of Computing Science
> > University of Glasgow
> > Glasgow
> > G12 8RZ
> > 
> > Tel: +44 (0)141 339 8855 ext 0989
> > E-mail: troup at dcs.gla.ac.uk
> > *********************************
> > 
> > _______________________________________________
> > biojava-dev mailing list
> > biojava-dev at biojava.org 
> > http://biojava.org/mailman/listinfo/biojava-dev
> > 
> =======================================================================
> Attention: The information contained in this message and/or attachments
> from AgResearch Limited is intended only for the persons or entities
> to which it is addressed and may contain confidential and/or privileged
> material. Any review, retransmission, dissemination or other use of, or
> taking of any action in reliance upon, this information by persons or
> entities other than the intended recipients is prohibited by AgResearch
> Limited. If you have received this message in error, please notify the
> sender immediately.
> =======================================================================
> 

-- 


*********************************
Tim Troup
Room F151
17 Lilybank Gardens
Department of Computing Science
University of Glasgow
Glasgow
G12 8RZ

Tel: +44 (0)141 339 8855 ext 0989
E-mail: troup at dcs.gla.ac.uk
*********************************