<div dir="ltr">Hi Halima,<div><br></div><div>I think your script is fine, but the sequence isn't in the genome you are blasting against. </div><div> </div><div>If you remove the entrez_query you get results from other organisms and if you change Beutenbergia to Acaryochloris (the best hit with no entrez_query) you get results. </div>
<div><br></div><div>Also, I tried to blast online against the Beutenbergia genome and didn't get good results. Is it possible you aren't blasting the sequence you intended?</div><div><br></div><div>Jessica</div>
</div><div class="gmail_extra"><br><br><div class="gmail_quote">On Fri, Jul 11, 2014 at 7:23 AM, halima saker <span dir="ltr"><<a href="mailto:hsaker@hotmail.com" target="_blank">hsaker@hotmail.com</a>></span> wrote:<br>
<blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex">
<div><div dir="ltr"><span><span><pre><code>from Bio import Entrez, SeqIO
from Bio.Blast import NCBIXML
from Bio.Blast import NCBIWWW
result_handle = NCBIWWW.qblast("blastn","nr", "CACTTATTTAGTTAGCTTGCAACCCTGGATTTTTGTTTACTGGAGAGGCC",entrez_query='"Beutenbergia cavernae DSM 12333" [Organism]')
blast_records = NCBIXML.parse(result_handle)
for blast_record in blast_records:
for alignment in blast_record.alignments:
for hsp in alignment.hsps:
print(hsp.query[0:75] + '...')
print(hsp.match[0:75] + '...')
print(hsp.sbjct[0:75] + '...')<br><br><br><br></code><span><span>this does not give me an output, although the sequence is actually a
sequence of the genome, so i must get a result. where is the error? the
query is correct?</span></span></pre></span></span> </div></div>
<br>_______________________________________________<br>
Biopython mailing list - <a href="mailto:Biopython@mailman.open-bio.org">Biopython@mailman.open-bio.org</a><br>
<a href="http://mailman.open-bio.org/mailman/listinfo/biopython" target="_blank">http://mailman.open-bio.org/mailman/listinfo/biopython</a><br></blockquote></div><br></div>