[Biopython] How to do RNA-RNA hybridization searches?

[Eric Ma]

Hi everybody,

I'm looking to try my hand at doing the following problem:

I have a sequence of RNA, say, "RNA SEQUENCE 1":
"...CGACGUAUGUUAUGAGCUGAUGGUCACGUGUCGAUGGCUAUAG..."

I have another sequence of RNA, say "RNA SEQUENCE 2".

I'd like to do 15-mer sliding window searches from RNA Sequence 1 (it'll
take a long time, I'm sure, but nonetheless that's what I'd like to do),
such that I search:

"[*CGACGUAUGUUAUGA*]GCUGAUGGUCACGUGUCGAUGGCUAUAG"
"C[*GACGUAUGUUAUGAG*]CUGAUGGUCACGUGUCGAUGGCUAUAG"
"CG[*ACGUAUGUUAUGAGC*]UGAUGGUCACGUGUCGAUGGCUAUAG" etc. etc.

along RNA Sequence 2, to see if I can find that same region present.

I was wondering if there was some package that could do that, that either
BioPython interfaces with, or is separately implemented as a Python
package. Does anybody know if there is such a thing?

Cheers,
Eric
-----------------------------------------------------------------------
Please consider the environment before printing this e-mail. Do you really
need to print it?

http://about.me/ericmjl