[Bioperl-l] Bio::BroodComb - RFC

[Chris Fields]

Jay,

Did you want to release it to CPAN?  I'll take a closer look at the docs to get an idea of what you are doing with it, but from my perspective I can see this becoming a nice general use tool akin to Bio::Perl, maybe a bit more lightweight.

chris

On Jan 18, 2010, at 6:22 PM, Jay Hannah wrote:

> I formalized a little framework so I could stop re-writing little programs that do some things people frequently ask me to do.
> 
>   http://github.com/jhannah/bio-broodcomb
> 
> It stores everything in SQLite so users can write custom reports if they want to. It uses BioPerl and some shiny CPAN beads (DBIx::Class, Moose::Role). Tests included. 
> 
> The first two functions I stuck in the framework:
> 
> Find subsequences (Bio::BroodComb::SubSeq):
> 
>   use Bio::BroodComb;
>   my $bc = Bio::BroodComb->new();
>   $bc->load_large_seq(file => "large_seq.fasta");
>   $bc->load_small_seq(file => "small_seq.fasta");
>   $bc->find_subseqs();
>   print $bc->subseq_report1;
> 
> In-silico PCR (Bio::BroodComb::PCR):
> 
>  use Bio::BroodComb;
>  my $bc = Bio::BroodComb->new();
>  $bc->load_large_seq(file => "large_seq.fasta");
>  $bc->add_primerset(
>     description    => "U5/R",   # however you want it reported
>     forward_primer => 'GCGGGCAGCAATACTGCTTTGTAA',
>     reverse_primer => 'ACCAGCGTTCAGCATATGGAGGAT',
>  );
>  $bc->find_pcr_hits();
>  $bc->find_pcr_products();
>  print $bc->pcr_report1;
> 
> I find this rather handy, so will probably be adding all my applicable future work to it instead of writing stand-alone programs. Not sure if it should be renamed for eventual CPAN / wherever.
> 
> Suggestions, contributions welcome.   :)
> 
>   http://github.com/jhannah/bio-broodcomb
> 
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l