[Bioperl-l] PAML + Codeml problem..

[Jason Stajich]

Saurabh -

a) These sequences are identical except for difference in length so  
there isn't going to be any interesting values from PAML, but maybe  
you are just providing an example?
b) I think you are missing the trailing gaps in the alignment of the  
Rv3923c_mtb_cdc1551 sequence as it is shorter PAML requires aligned  
sequences as input.
c) The sequences, in the reading frame you have provided (and using  
the standard translation table), have stop codons in them, this will  
cause failure as well.

Which code from the wiki are you running, the 'running PAML' part of  
the HOWTO?

Try looking at the actual output from PAML to figure out what is wrong.
Add this when initializing the Run object:
-save_tempfiles => 1,
-verbose => 1,

then open up the tempdir that is reported and look at the output  
files (mlc file).

-jason

On May 8, 2006, at 11:38 AM, Johri, Saurabh wrote:

> Hi all,
>
> I'm trying to use codeml from PAML to estimate Ka, Ks values from
> sequences within a multi fasta file:
> i'm using the code which has been posted on the bioperl wiki...
>
> However, when I run the code, i get the following errors:
>
> I did a google search to see if anyone had come across similar
> problems.... in which case the problem seems to have been due to the
> sequences not being a multiple of 3,
> In my code I check if the sequence is a multiple of 3 and if  not, i
> alter the sequences until this is the case, although I still have the
> same error messages,
>
> Any suggestions as to why this could be happening?
>
> Thanks!!!
>
> Saurabh Johri
> Tuberculosis Research Group
> Centre for Molecular Microbiology & Infection
> Imperial College London
> SW7 2AZ
>
>
>
>
> -------------------- WARNING ---------------------
> MSG: There was an error - see error_string for the program output
> ---------------------------------------------------
>
> ------------- EXCEPTION Bio::Root::NotImplemented -------------
> MSG: Unknown format of PAML output
> STACK Bio::Tools::Phylo::PAML::_parse_summary
> /sw/lib/perl5/5.8.6/Bio/Tools/Phylo/PAML.pm:359
> STACK Bio::Tools::Phylo::PAML::next_result
> /sw/lib/perl5/5.8.6/Bio/Tools/Phylo/PAML.pm:224
> ------------------------------------
>
>> Rv3923c
> caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccg 
> ag
> gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcg 
> ac
> ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
> gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacg 
> gt
> acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcacc 
> gc
> aaataagcccggtgttgcaatcaa
>> Rv3923c_mtb_cdc1551
> caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccg 
> ag
> gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcg 
> ac
> ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
> gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacg 
> gt
> acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcac
>> Rv3923c_mtb_f11
> caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccg 
> ag
> gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcg 
> ac
> ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
> gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacg 
> gt
> acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcacc 
> gc
> aaataagcccggtgttgcaatcaa
>> Rv3923c_mtb_c1
> caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccg 
> ag
> gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcg 
> ac
> ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
> gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacg 
> gt
> acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcacc 
> gc
> aaataagcccggtgttgcaatcaa
>> Rv3923c_mtb_210
> caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccg 
> ag
> gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcg 
> ac
> ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
> gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacg 
> gt
> acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcacc 
> gc
> aaataagcccggtgttgcaatcaa
>> Rv3923c_mbovis
> caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccg 
> ag
> gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcg 
> ac
> ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
> gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacg 
> gt
> acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcacc 
> gc
> aaataagcccggtgttgcaatcaa
>
> ------------------------------------
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12